Alma Mater Studiorum – Università di Bologna - AMS Dottorato

Alma Mater Studiorum – Università di Bologna - AMS Dottorato

Alma Mater Studiorum – Università di Bologna DOTTORATO DI RICERCA IN SCIENZE E TECNOLOGIE AGRARIE, AMBIENTALI E ALIMENTARI Ciclo XXVII Settore Concor...

7MB Sizes 0 Downloads 0 Views

Recommend Documents

Alma Mater Studiorum Università di Bologna - AMS Dottorato
partire dai 60 anni, il 50-70% dei pazienti con DS sviluppa demenza senile ... di placche senili; il danno ossidativo ed

Alma Mater Studiorum – Università di Bologna - AMS Dottorato
Case C-126/97, Eco Swiss China Time Ltd v Benetton International NV. [1999] I-3055. • Case C-453/99, Courage v. Bernar

Alma Mater Studiorum – Università di Bologna - AMS Dottorato
Mar 5, 2010 - 3.3.4 Plasma treatment of electrospun separators . 35. Chapter 4 .... charge/discharge cycles . ...... The

Alma Mater Studiorum – Università di Bologna - AMS Dottorato
cocoa solids in cocoa butter, while milk chocolate contains milk solids and milk ... than 35 % total dry cocoa solids, i

ALMA MATER STUDIORUM - UNIVERSITA' DI BOLOGNA SCUOLA
and the phenomenon of daigou and counterfeit purchase, I analyzed Prada marketing mix strategy in China with product, pr

ALMA MATER STUDIORUM - UNIVERSITÀ di - AMS Tesi di Laurea
love so much in Disney's rendering, was nothing more than the story of an .... is the only tale where the princess alrea

Le Antichità di Bologna di Bartolomeo della Pugliola - AMS Dottorato
Bartolomeo della Pugliola, frate dell'ordine dei Minori Conventuali, è mandato dai superiori del suo .... BARONE, La le

tesi dottorato defitivita - AMS Dottorato
GABRIELE BALDUCCI. Prof. FABIO PEZZI ..... del prodotto (dato dal fatto della grande quantità di prodotto ammostato) e

Schema frontespizio teso Dottorato - AMS Dottorato
List of Figures. 6 .... African Union‟s Inter-african Bureau of Animal Resources ..... forced by destitution to depend

Facsimile del frontespizio della tesi di dottorato - AMS Dottorato
Mar 11, 2015 - of oil is equivalent to ten minutes of operation at low power or three ...... sidering the average per ca

Alma Mater Studiorum – Università di Bologna DOTTORATO DI RICERCA IN

SCIENZE E TECNOLOGIE AGRARIE, AMBIENTALI E ALIMENTARI Ciclo XXVII Settore Concorsuale di afferenza: 07/G1 Settore Scientifico disciplinare: AGR/17

TITOLO TESI

IDENTIFICATION OF CNV AND QTL FOR PRODUCTIVE AND FUNCTIONAL TRAITS IN DAIRY CATTLE USING DENSE SNP CHIPS

Presentata da:

Alessandro Bagnato

Coordinatore Dottorato

Relatore

Prof. Giovanni Dinelli

Prof. Luca Fontanesi

Esame finale anno 2015

CONTENTS

General Introduction General Introduction References

Page 3 7

Aim

8

CHAPTER 1 Identification and Validation of Copy Number Variants in Italian Brown Swiss Dairy Cattle Using Illumina Bovine SNP50 Beadchip

9

CHAPTER 2 Quantitative Trait Loci Mapping for Conjugated Linoleic Acid, Vaccenic Acid and D9-Deasaturase in Italian Brows Swiss Dairy Cattle Using Selective DNA Pooling

66

CHAPTER 3 Genome-Wide Association Study for Somatic Cell Score in Valdostana Red Pied Cattle Breed Using Pooled DNA

94

General Conclusion

!

121

2!

GENERAL INTRODUCTION Genomic Selection in livestock populations The relatively recent application of genomic selection in cattle (Meuwissen et al 2001, Goddard & Hayes, 2009) is based on the association of genomic variants to phenotypic variation. The identification and knowledge of genomic structural variation associated to phenotypic variability can be used in populations to select individuals and improve the accuracy and efficiency of selection schemes. The recent advances in sequencing and SNP genotyping technologies, together to reduction in costs, delivered in livestock populations a large amount of genomic data. Projects like the 1000K Bull genome project (Hayes et al. 2013) focussed on the identification of SNP structural variation from genome wide sequence data, disclosing million of mutations in the bovine genome. The possibility to use genotyping by sequencing technologies, as in the 1000k Bull genome project, is driving the methods to improve the accuracy of genomic information, used as inputs in genomic evaluation, at maximum possible: i.e. at individual sequence level. This is the major goal in the genomic evaluation research field, as the accuracy of genomic selection is a key factor in the success of many breeding companies among livestock species. Nevertheless other source of structural variants may play a role in improving accuracy of genomic selection. Among those the Copy Number Variants (CNV). The disclosure of other structural variants and their possible association with complex trait variation (Redon et al 2006) encouraged the mapping of CNV in cattle populations and the subsequent validation of these structural variants as markers for genomic selection. Recent studies (Clop et al., 2012) have mapped CNV in several livestock populations indicating them as an additional source of genetic variation that can be possibly used in selection of individuals. If it is true that genomic selection process is trying to improve its accuracy using SNP genotyping by sequencing and CNV as markers, selection in livestock is also looking towards novel traits. Selection in the past decades was directed towards improvement of quantity and quality of production. Nowadays functional traits are more and more a priority in selection schemes. Additionally nutritional properties of food, as content of specific fatty acids, are of possible interest for breeding purposes (Stoop et al. 2008)

!

3!

Identification of genomic region harbouring genes involved in resistance to specific diseases (e.g. mastitis in dairy cattle) or in fatty acid content in milk has been the goal of several research project in the recent past . Genome Wide Association Studies (GWAS) have been developed in the last decades to identify chromosomal regions linked to genes involved in functional traits and in nutritional properties of food. Copy Number Variants The term Copy number variants (CNVs) appeared in a review by Feuk et al. (2006) describing DNA segments, originally bigger than 1 kb, that differ in copy number among individuals. As compared to a reference sample they can be classified as deletions, insertions and duplications (Lee and Scherer, 2010). CNVs are a structural variation much less abundant than Single Nucleotide Polymorphisms in the genome. However they can affect the DNA sequence up to several megabases making the inter individual variability based on CNVs much higher, as highlighted by Redon et al. (2006) who published the first comprehensive CNV maps in human. Clop et al. (2012) published a review on CNV mapped in the domestic animals including mammals and avian species. Studies on CNV have advanced from simple mapping studies to population genetics of structural variants and in assessing the influence of CNVs on phenotypic variation. Several studies in humans have shown the possible impact of CNV on susceptibility to certain complex disease and disorders as Crohn’s disease, susceptibility to HIV/AIDS and Kawasaki disease, autism, bipolar disorder, schizophrenia, age-related macular degeneration

and

cancer

(see

Estivil

and

Armengol

http://www.nature.com/ejhg/journal/v18/n8/full/ejhg201035a.html - bib4, 2007, Wain et al., 2009; Lee and Scherer, 2010; Almal and Padh, 2011) As reported in a review by Clop et al, (2012) in livestock coat color is, in several species, partly determined by CNVs. Array comparative genomic hybridisation (aCGH), has been the first technology available to perform whole genome scans for CNVs in a single experiment. With the decrease in costs of SNP genotyping arrays, these are today’s the main standard for CNV detection. Nonetheless with ever decreasing costs and ever higher output, high throughput sequencing techniques are becoming a major player in the structural variation detection, including CNVs. !

4!

SNP array based studies usually compare to the reference population used in the array design or a large reference dataset specific to the population under study. Several algorithms has been developed to map CNV from information delivered by SNP array as Log R Ratio and B Allele Frequency. Among those PennCNV, CNAM (Golden Helix), CNVnator are the most and widely used in CNV mapping studies. GWAS for Health and Nutritional Traits in Dairy Cattle Mastitis is one of the major costly disease in dairy cattle causing a loss of about 200 Euro per case of infection. Selection for mastitis resistance is undergoing in cattle populations for over a decade using the Milk Somatic Cell Count (SCC) as indicator of mastitis susceptibility. A large number of studies have mapped Quantitative Trait Loci related to SCC using microsatellite and SNP markers. More recently interest for bioactive compounds in food have raised the attention of researcher to investigate the genetic bases of nutritional components in milk, as fatty acids content (Stoop et al. 2008). Among the fatty acids, Conjugated Linoleic Acid has been extensively studied in livestock as nutritional component in meat and milk. CLA nutritional properties and their predicted effect on human health has been in fact widely studied. In livestock a portal grouping a wide range of data bases1 reporting QTL, candidate gene, association data from GWAS and copy number variations mapped on genomes is available at www.animalgenome.org. Among the various databases, the Cattle QTLdb, regularly updated, reports about 9,180 QTL for 472 different traits2. Among those traits those related to mastitis resistance and to fatty acid content. QTL for mastitis resistance The phenotypes widely used to study the resistance to mastitis are the milk somatic cell count (SCC) and its log transformation, somatic cell score (SCS).The reason resides in the possibility to record the measure during functional recording and for the positive and strong genetic correlation with clinical mastitis occurrence that range from .50 to more than .90 according to studies and populations (Rupp and Boichard 2003, Samoré et al. 2008).

1

Examples of Livestock animal QTL databases: AnimalQTLdb (http://www.animalgenome.org); Bovine QTL Viewer (http://genomes.sapac.edu.au/bovineqtl/); cgQTL database: QTL for milk production traits in cattle identified from expression experiments (http://cowry.agri.huji.ac.il/QTLMAP/qtlmap.htm). 2 (http://www.animalgenome.org/cgi-bin/QTLdb/BT/index).

!

5!

Several authors mapped the QTLs for mastitis resistance (SCC and SCS) and regions have

been

reported

on

almost

all

bovine

chromosomes

(www.animalgenome.org/QTLdb/)(Figure 1).

Clinical mastitis (CM)

Somatic Cell Count (SCC)

Somatic Cell Score (SCS)

Figure 1. Graphical representation of QTL on all bovine chromosomes associated to clinical mastitis (CM), somatic cell count (SCC) and somatic cell score (SCS). QTL for Fatty Acid Component Among the bioactive components in milk, the conjugated linoleic acids (CLA) is one of the most studied polyunsaturated fatty acids for its effect on human health. The precursor of CLA in milk fat is the Vaccenic acid (11-trans-octadecenoic acid; VA). Desaturation of VA to CLA (C18:2 cis-9, trans-11) occuring in the mammary gland (75-90%) and other tissues, is catalyzed by Δ9-Desaturase (D9D). The literature results of the studies mapping QTL for CLA, VA and D9D are graphically summarized in Figure 2 (http://www.animalgenome.org/cgi-bin/QTLdb/BT/index)

Milk conjugated linoleic acid percentage

Milk fatty acid unsaturated index

Milk trans-vaccenic acid percentage

Figure 2. Graphical representation of QTL associated with milk conjugated linoleic acid percentage, milk fatty acid unsaturated index and milk trans-vaccenic acid percentage on all bovine chromosomes. !

6!

GENERAL INTRODUCTION REFERENCES - Almal SH, Padh H (2011). Implications of gene copy-number variation in health and diseases. J Hum Genet doi: 10.1038/jhg.2011.108 - Clop A, Vidal O, Amills M (2012). Copy number variation in the genomes of domestic animals. Anim Genet doi: 10.1111/j.1365-2052.2012.02317.x. - Estivill X and Armengol L (2007). Copy number variants and common disorders: Filling the gaps and exploring complexity in genome-wide association studies. PLoS Genet 3:1787–1799. doi:10.1371/journal.pgen.0030190. - Feuk L, Carson AR, Scherer SW 2006. Structural variation in the human genome. Nat Rev Genet 7:85-97. - Goddard M.E., Hayes B.J. (2009). Mapping genes for complex traits in domestic animals and their use in breeding programmes..Nat Rev Genet. 10(6):381-91. - Hayes B.J., H. D. Daetwyler, R. Fries, B. Guldbrandtsen, M. S. Lund, D.A. Boichard, P. Stothard, R.F. Veerkamp, I.H.D. Rocha, C. Van Tassell, B. Gredler, T. Druet, A. Bagnato, M. Goddard, A. Chamberlain. PAG XXI, S. Diego, CA, USA, January 11-16 2013. P0764. - Koivula M., Mantysaari E. A., Negussie E. and Serenius T., 2005. Genetic and phenotypic relationships among milk yield and somatic cell count before and after clinical mastitis. J. Dairy Sci. 88:827–833. - Lee C and Scherer SW (2010). The clinical context of copy number variation in the human genome. Expert Rev Mol Med 12:e8, doi:10.1017/S1462399410001390. - Meuwissen, T. H. E., B. J. Hayes, and M. E. Goddard. 2001. Prediction of total genetic value using genome-wide dense marker maps. Genetics 157:1819–1829. - Redon R., Ishikawa S., Fitch K.R., Feuk L., Perry G.H., Andrews T.D., Fiegler H., Shapero M.H., Carson A.R. & Chen W. (2006) Global variation in copy number in the human genome. Nature 444: 444–454 - Samoré A. B., Groen A. F., Boettcher P. J., Jamrozik J., Canavesi F. and Bagnato A. (2008). Genetic correlation patterns between somatic cell score and protein yield in the Italian Holstein-Friesian population. J. Dairy Sci. 91:4013–4021. - Stoop, W. M., J. A. M. van Arendonk, J. M. L. Heck, H. J. F. vanValenberg, and H. Bovenhuis. (2008). Genetic parameters for major milk fatty acids and milk production traits of Dutch Holstein-Friesians. J. Dairy Sci. 91:385–394. - Wain LV, Armour JAL, Tobin MD (2009). Genomic copy number variation, human health and disease The Lancet, 374:340–350 doi:10.1016/S0140-6736(09)60249-X. !

7!

AIM The aim of the thesis is to identify CNV structural variants as possible markers for genomic selection and to identify QTL regions for Fatty Acid Content in the Italian Brown Swiss population. Additionally the identification of QTL for mastitis resistance in the Valdostana Red Pied cattle is a study that can be used to validate the QTL mapped in the Brown Swiss Population and to improve the selection accuracy in a native population. The mapping of CNV in the Brown Swiss population has been done using the Illumina Bovine SNP50 BeadChip, the most used in sire genotyping. The possibility to use the data from a medium density SNP array is here tested and CNV regions identified has been validated by qPCR. This study is exposed in Chapter 1 and was part of the EU funded project Quantomics “From sequence to consequence – tools for the exploitation of livestock genome”. The mapping of fatty acid content in the Italian Brown Swiss cattle population was the second objective of this thesis and was developed given the particular interest of the Brown Swiss Association (ANARB) for nutritional properties of milk. ANARB has been in fact one of the partners in 2 projects funded by Regione Lombardia: QuaLAT aimed to the identification of QTL for fatty acid contents in the Brown Swiss and Israel Holstein cattle populations; LattOMEGA aimed at identifying the basis for the implementation of selection for fatty acid contents in the Italian Brown Swiss and Italian Holstein selection schemes. The results are in Chapter 2. Chapter 3 shows the results relative to the objective to map QTL for mastitis resistance in the Valdostana Red Pied cattle population. The Valdostana Red Pied cattle breed is selected for double purpose, meat and milk. The expectation is that a part of the QTL mapped in this population overlaps those mapped in the other populations. Additionally it is expected that proprietary QTLs for mastitis resistance of the Valdostana Red Pied are disclosed. This study was part of the EU funded project Quantomics. In the final discussion some results relative to the CNV mapping in the Valdostana Red Pied are also reported with an overview to association of these markers with traits under selection. !

8!

CHAPTER 1

IDENTIFICATION AND VALIDATION OF COPY NUMBER VARIANTS IN ITALIAN BROWN SWISS DAIRY CATTLE USING ILLUMINA BOVINE SNP50 BEADCHIP

Alessandro Bagnato*§1, Maria Giuseppina Strillacci*1, Laura Pellegrino*1, Fausta Schiavini*, Erika Frigo*, Attilio Rossoni^, Luca Fontanesi§, Christian Maltecca&, Raphaelle Teresa Maria Matilde*, Marlies Alexandra Dolezal†

* Department of Health, Animal Science and Food Safety (VESPA), University of Milan, Via Celoria 10, 20133, Milan, Italy †

Institut für Populationsgenetik Veterinärmedizinische, University Wien, Josef Baumann

Gasse 1, 1210 Wien, Austria §

Department of Agricultural and Food Sciences, Division of Animal Sciences, University of

Bologna, Viale Fanin 46, 40127 Bologna, Italy ^Associazione Nazionale Allevatori Razza Bruna, Loc. Ferlina 204, 37012 Bussolengo (VR), Italy &

North Carolina State University, Raleigh, NC 27695, USA

1) the first three authors contributed equally to this work Corresponding author: Alessandro Bagnato, Dipartimento di Scienze Veterinarie per la Salute, la Produzione Animale e la Sicurezza Alimentare, Università degli Studi di Milano, Via Celoria 10, 20133 Milano, Italy - Tel +39 02 50315740 - Fax: +39 02 50315746 – Email: [email protected]

Submitted for publication to Italian Journal of Animal Science

!

9!

1.1 ABSTRACT The determination of copy number variation (CNV) is very important for the evaluation of genomic traits in several species because they are a major source for the genetic variation, influencing gene expression, phenotypic variation, adaptation and the development of diseases. The aim of this study was to obtain a CNV genome map using the Illumina Bovine SNP50 BeadChip data of 651 bulls of the Italian Brown Swiss breed. PennCNV and SVS7 (Golden Helix) software were used for the detection of the CNVs and Copy Number Variation Regions (CNVRs). A total of 5,099 and 1,289 CNVs were identified with PennCNV and SVS7 software, respectively. These were grouped at the population level into 1,101 (220 losses, 774 gains, 107 complex) and 277 (185 losses, 56 gains and 36 complex) CNVR. Ten of the selected CNVR were experimentally validated with a qPCR experiment. The GO and pathway analyses were conducted and they identified genes (false discovery rate corrected) in the CNVR related to biological processes, cellular component, molecular function and metabolic pathways. Among those, we found the FCGR2B, PPARα, KATNAL1, DNAJC15, PTK2, TG, STAT family, NPM1, GATA2, LMF1, ECHS1 genes, already known in literature because of their association with various traits in cattle. Although there is variability in the CNVRs detection across methods and platforms, this study allowed the identification of CNVRs in Italian Brown Swiss, overlapping those already detected in other breeds and finding additional ones, thus producing new knowledge for association studies with traits of interest in cattle. Keywords: CNV, Italian Brown Swiss breed, Illumina Bovine SNP50 BeadChip, qPCR

1.2 INTRODUCTION The understanding of the genetic variation in livestock species, such as cattle, is crucial to associate genomic regions to the traits of interest. Copy Number Variations (CNVs) are polymorphic DNA regions including deletions, duplications and insertions of DNA fragments from at least 0.5 kb to several Mb, that are copy number variable when compared with a reference genome (Jiang et al., 2013). The CNVs are important sources of genetic diversity and provide structural genomic information comparable to single nucleotide polymorphism (SNP) data; they influence gene expression, phenotypic variation, environmental adaptability and disease susceptibility (Wang et al., 2009). !

10!

The development of SNP arrays allowed the identification of CNVs by high-throughput genotyping on different types of cattle breeds. CNV loci were identified in several indicine and taurine breeds, and CNV maps of the bovine genome, using SNPs, Next Generation Sequencing (NGS) and CGH arrays, were reported (Matukumalli et al., 2009; Bae et al., 2010; Fadista et al., 2010; Hou et al., 2012; Bickhart et al., 2012). In livestock, recent studies underlined the effects of the CNVs in intron 1 of the SOX5 gene causing the pea-comb phenotype in chickens (Wright et al., 2009), in the STX17 gene responsible for premature hair graying and susceptibility to melanoma in horses (Rosengren et al., 2008). Also, the CNVs in the ASIP gene are responsible in the leading of different coat colours in goats (Fontanesi et al., 2009). In cattle, Meyers et al. in 2010 identified the association between CNVs in a deletion state in the SLC4A2 gene and osteoporosis in Red Angus cows. Additionally, it has been reported that a Copy Number Variation Region (CNVR) located on BTA18 is associated with the index of total merit and protein production, fat production and herd life in Holstein cattle (Seroussi et al., 2010). Several CNV detection algorithms based on SNP array are available (Xu et al., 2013). Winchester et al. (2009), Pinto et al. (2011) and Tsuang et al. (2010) recommended the use of a minimum of two algorithms for the identification of CNVs in order to reduce the false discovery rates as the algorithms differ in performance and impact in CNV calling (Xu et al., 2013). The Italian Brown Swiss breed represents the Italian strain of the Swiss Brown Alpine Breed, originally native of central Switzerland. The typical rusticity of the breed, together with its good production attitude, have leaded its spread all over many European and American countries, with the differentiation of different genetic groups in relation to various environmental conditions. The milk of the Italian Brown Swiss breed has a good cheese-making attitude due to the low frequency of the allele A of the K-casein, in respect to other breeds (http://www.anarb.it/). In order to support the attitude of the Italian Brown Swiss breed milk to be processed for cheese making, the Associazione Nazionale Allevatori Razza Bruna Italiana (ANARB) sponsored the “disolabruna®” registered mark used for the commercialization of typical cheeses

made

with

only

milk

coming

from

Brown

Swiss

breed

cows

(http://www.disolabruna.it/). Nowadays in literature, there is not a whole-genome CNV map for the Italian Brown Swiss in a large population dataset. The aim of this study was to obtain a consensus CNV !

11!

genome map in the Italian Brown Swiss cattle based on the Illumina Bovine SNP50 BeadChip and two SNP based CNV calling algorithms. 1.3 MATERIALS AND METHODS 1.3.1 Sampling and genotyping ANARB provided commercial semen samples for 1,342 bulls. Genomic DNA was extracted from semen using the ZR Genomic DNA TM Tissue MiniPrep (Zymo, Irvine, CA, U.S.A.). Sample DNA was quantified using NanoQuant Infinite®m200 (Tecan, Männedorf, Switzerland) and diluted to 50 ng/µl as required to apply the Illumina Infinium protocol. DNA samples were genotyped using Illumina Bovine SNP50 BeadChip (Illumina Inc., San Diego, USA) interrogating 54,001 polymorphic SNPs with an average probe spacing of 51.5 kb and a median spacing of 37.3 kb. In this study, the UMD3.1 assembly was used as the reference genome. 1.3.2 Editing data All SNPs were clustered and genotyped using the Illumina BeadStudio software V.2.0 (Illumina Inc.). Samples that showed a call rate below 98% were excluded for the CNV detection. The signal intensity data of Log R Ratio (LRR) and B allele frequency (BAF) were exported from the Illumina BeadStudio software and the overall distribution of derivative log ratio spread (DLRS) values was used in the SVS7 software (Golden Helix Inc.) to identify and filter outlier samples, as described by Pinto et al., 2011. Principal component analysis (PCA) for LRR was performed using the SVS7 software to detect the presence of batch effects and correct the signal intensity values accordingly. Samples with extreme wave factors were excluded from the analysis through the SVS7 software wave correction algorithm. This because waviness is hypothesized to be correlated with the GC content of the probes in addition to the GC content of the region around the probes (Diskin et al., 2008). 1.3.3 CNVs detection Two

softwares

were

chosen

for

the

detection

of

CNVs:

PennCNV

(http://www.openbioinformatics.org/penncnv/) and Copy Number Analysis Module (CNAM) of SVS7 software. The use of two software based on different algorithms has the final aim to reduce the false discovery calls resulting from the limitations of the identification of CNVs based on the Illumina Bovine SNP50 BeadChip. !

12!

1.3.4 PennCNV detection PennCNV is the freely available most commonly utilized software for CNV calling in bovine studies; it considers multiple sources of information, among those the LRR and BAF at each SNP. Also, the software reports data quality control measurements for each CNV dataset. Individual-based CNV calling was performed by PennCNV for all autosomes, using the default parameters of the Hidden Markov Model (HMM). The HMM is a statistical technique that assumes that the distribution of an observed intensity data point depending on an unobserved (hidden) copy number state at each locus, where the elements of the hidden states follow a Markov process (Wang., et al., 2007). To reduce the false discovery rate in CNVs calling we used high quality samples with a standard deviation (SD) of LRR <0.30 and with default set of BAF drift as 0.01. In addition, we deleted the CNVs which overlapped at least 10% of telomere length (the first and last 500 kb of each autosome were considered representing the telomeres). 1.3.5 SVS7 detection SVS7 software has a user-friendly graphical interface, efficient pipelines for analysis and workflow, optimized computational speed as well as a technical support. The univariate analysis was used for the CNVs identification. The univariate method segments each sample independently, resulting efficient to find individual variations. The criteria considered for the analysis were: univariate outlier removal, a maximum of 10 per 10,000 markers, with a minimum of 1 marker per segment, and 2,000 permutations per segment pair p-value cut-off of 0.005. 1.3.6 CNVRs definition CNVRs were defined as in Redon et al. (2006) with the BedTools software (Quinlan et al., 2010) within software. In addition, consensus regions were created among those identified within the two software, using the Wain et al. (2009)’s approach, which identified only CNVRs that fully overlapped each other. 1.3.7 CNVRs validation by quantitative PCR Quantitative PCR (qPCR) experiments were performed to validate the CNVRs among those identified. The BTF3 gene was selected as a reference location for all qPCR experiments (Bae et al., 2010). Primers for the selected target regions and for the !

13!

reference gene were designed with the Primer Express® Software v3.0.1 (Life Technologies™) using the minor groove binder (MGB) quantification parameters. All the qPCR experiments were run in quadruple using the qPCR protocol described by TaqMan® Copy Number Assays kit (Life Tecnologies™) on 7500 Fast Real-time PCR System instrument (Applied Biosystems, Life Technologies™). The samples for each qPCR experiment were randomly selected with or without CNVs for each CNVR. The analysis of the crossing thresholds (Ct) for each samples tested was carried out using CopyCaller™ software (Applied Biosystems). The validated CNVR positions were converted from Bos_taurus_UMD3.1 to Btau_4.6.1 assembly using the Batch Coordinate Conversion option in the UCSC database (https://genome.ucsc.edu/) in order to identify potential candidate CNV genes for complex traits. 1.3.8 CNVR annotation The full Ensembl v76 gene set for the autosomal chromosomes was downloaded (http://www.ensembl.org/biomart/martview/76d1cab099658c68bde77f7daf55117e). A gene ontology (GO) and pathways analyses using the DAVID Bioinformatics Resources 6.7 (http://david.abcc.ncifcrf.gov/) were performed (using the high classification stringency option and the false discovery rate (FDR) correction) to identify molecular functions, biological processes, cellular components and pathways for the genes included in the consensus CNVRs.

1.4 RESULTS AND DISCUSSION The application of stringently quality filters above described reduced the number of bull samples to be analysed to 651. 1.4.1 CNVs and CNVRs detection Table 1 shows the descriptive statistics of the identified CNVs length using PennCNV and SVS7 softwares. Using PennCNV, a total of 5,099 CNVs were detected, located in all 29 autosomes with a mean size of 350 kb (±165.259) ranging from 40.4 kb to 4.46 Mb (median = 230 kb). The highest number of CNVs was detected on BTA7 (8.4%). In detail, the homozygous deletion, heterozygous deletion and the heterozygous duplication CNVs with the highest frequency were observed on BTA5 (12.4%), BTA7 (13.4%), BTA2 (7.9%), respectively. Only one homozygous duplication CNV was identified on BTA25. !

14!

A total of 1,289 CNVs were identified by SVS7 in all the 29 autosomes. The length of the CNVs ranged from 11.3 kb to 1.4 Mb with median and average values equal to 45 kb and 88.9 kb, respectively. The highest frequency of gain (23.9%) and loss (21%) CNVs were detected on BTA28, which also showed the highest number of CNVs in total (22.2%). The discrepancies among the number of CNVs detected from the two software packages is ascribed to the lack of identification of shorter CNVs of the SVS7 univariate approach (here used) (http://doc.goldenhelix.com/). A graphical representation of CNVs obtained by PennCNV and SVS7 software for each chromosome was visualized by HD-CNV software (http://daleylab.org/lab/?page_id=125) and reported in Figure 1. The graph files allow the visualization of the regions where CNVs were observed across samples with a strong amount of overlap. A total of 1,101 CNVRs were mapped with PennCNV software (Table 2). The total length of the sequence covered by the CNVRs was 682 Mb, which corresponded to 27.14% of the bovine autosomal genome in the Brown Swiss breed. The percentage of sequence covered by CNVRs by chromosome ranged from 16.59 (BTA 12) to 50.14 (BTA 19). The CNVs identified with SVS7 software were summarized at the population level according to Redon et al. (2006)’s approach, resulting into 277 CNVRs (Table 2). The total length of the sequence covered by the CNVRs was 33.71 Mb (1.35%) of the bovine autosomes. The percentage by chromosome of sequence covered by CNVRs ranged from 0.12 (BTA 10) to 3.5 (BTA 12). The highest frequency of CNVRs were identified on BTAs 8 and 4 for PennCNV and SVS7 software, respectively. The consensus performed between the two software generated 150 consensus CNVRs with a total length of 17.1 Mb (0.68 % of the autosomes), as shown in Supplementary File 1. Table 3 shows the comparison between the CNVRs detected and those reported in literature, confirming both the existence of high variability in CNVRs detection across platforms, methods, population size, cattle breeds and species. It is evident that only a small proportion of CNVRs in our study overlapped with those in other studies, probably because only the 150 consensus CNVR were considered in the comparison, to enhance the power of CNVs detection in this study. The highest overlapping coverage (38%) was found with the study of Hou et al. (2011), in which CNVs detection was performed using BovineSNP50 assay including animals from taurine dairy and beef breeds, breeds of predominantly indicine back-ground, Taurine × Indicine composite and African groups. The previous mentioned dataset included 24 Brown Swiss individuals in which 22 CNVRs were identified on 13 BTAs. Only one CNVR !

15!

on BTA9 from Hou et al. (2011) (4305338 -4386831 Mbp) resulted in common with the region identified in our study (4050528-4476378 Mbp). The comparison between CNVRs here identified with PennCNV software and those detected in the study of Hou et al. (2011) in Brown Swiss cattle, using the same software, provided five common CNVRs on BTAs 2, 9, 12, 14, 18. The Table 4 shows a list of the QTL

included

in

these

regions

(http://www.animalgenome.org/QTLdb/doc/genomeversion#UMD_3.1). Since some QTL covered very large chromosome regions, we considered only those with a small interval of confidence. 1.4.2 CNVRs validation by quantitative PCR Eleven CNVRs were selected for the validation; three of which were in common between PennCNV and SVS7 software, six and two of which were randomly chosen among the CNVRs identified with the two software, respectively. Supplementary File 2 reports the primer list for the eleven regions. Ten CNVRs (91%) were confirmed by qPCR experiments. Additionally, the proportions of confirmed positive CNVs in each sample varied from 50% to 100% in each of the confirmed CNVRs; however, the average of false negative rate was equal to 25%. Jiang et al. (2013) reported similar values rates in the Holstein breed. 1.4.3 CNVRs annotation Supplementary File 3 shows the 252 Ensembl annotated genes, which correspond to 218 gene symbols in the consensus CNVRs. Supplementary File 4 reports the GO and the pathways analyses for 158 genes among those included in Supplementary File 3. The KEGG pathway analysis revealed that these genes are mainly represented in the pathway of immune system. Among the identified genes, in Table 5 we highlighted those showing differential expression of association with various traits in cattle reported in literature. In detail, Lewandowska-Sabat et al. (2013) in their in vitro study, highlighted the role of the TREM1 (triggering receptor expressed on myeloid cells 1) signaling pathway in which the FCGR2B (Fc fragment of IgG, low affinity IIb, receptor (CD32)) gene is included. The TREM1, in synergy with the TLR2 (Toll-like receptor 2) pathway, are involved in phagocytosis and production of proinflammatory cytokines, determining optimal host defense during bovine mastitis.

!

16!

The PPARα gene, encoding for the peroxisome proliferator-activated receptor-α, maps in the CNVRs found in this study on BTA5. The role of this gene in the fatty acid metabolism is widely described in literature (Bionaz et al., 2013) The CNVRs detected on BTA12 in our study enclose the KATNAL1 (Katanin p60 subunit A-like 1) and DNAJC15 (DnaJ (Hsp40) homolog, subfamily C, member 15) genes. Zhang et al. (2014) characterized the KATNAL1 gene and found the promoter polymorphism associated with semen traits in Chinese bulls. Moreover, SNPs in the DNAJC15 gene were found to be associated with bovine blastocyst rate by Zhang et al. (2011). The polymorphism in the PTK2 (Protein tyrosine kinase 2) gene, annotated in one of the CNVR on BTA14 was found to be associated with milk production traits in Chinese Holstein (Wang et al., 2013). On the same BTA, the gene encoding for the thyroglobulin (TG) was associated with fat distribution, carcass and meat traits in beef cattle (Bennet et al., 2013). Fernàndez et al. (2014) also found the association of SNPs in the TG gene with age of puberty in bulls. The STAT3 (signal transducer and activator of transcription 3 (acute-phase response factor)), the STAT5B (signal transducer and activator of transcription 5B) and the STAT5A (signal transducer and activator of transcription 5A) genes are annotated in the CNVR on BTA19 detected in our study.

The main bovine STATs family members STAT3 and

STAT5 are involved in prolactin receptor (PRLR) signaling by JAK/STAT pathway (Janus kinase (JAK) and Signal Transducer and Activator of Transcription) that activates the expression of milk protein genes (Zhang et al., 2010). The NPM1 gene (nucleophosmin 1) is located in the CNVR found on BTA20. This gene encoding a multifunctional nucleolar phosphoprotein that plays a crucial role in the control of various aspects of cell growth and homeostasis, is a candidate gene for growth traits in cattle (Huang et al., 2010) The GATA2 (GATA binding protein 2) gene, included in the CNVR on BTA22, is involved in the regulation of trophoblast-specific gene transcription in bovine trophoblast CT-1 cells, as described by Bai et al. (2011). The LMF1 (lipase maturation factor 1) gene maps in the CNVR found on BTA25. The mutations of this gene are involved in glyceridemia and hypertriglyceridemia in human and animals, playing an important role in the lipase maturation (Ren et al., 2011). The ECHS1 (enoyl coenzyme A hydratase, short chain, 1) gene, included in the CNVR on BTA26, was associated with the conjugated linoleic and vaccenic acids in milk in a

!

17!

quantitative trait loci mapping study of Strillacci et al. (2014) in the Italian Brown Swiss cattle breed. 1.5 CONCLUSIONS In this study, the first on this breed on a such a large number of individuals, we detected CNVs in the Italian Brown Swiss cattle population based on whole genome SNP genotyping data, using two software packages (PennCNV and SVS7), with the aim to reduce the high error rate commonly recognised in copy number discovery. CNVRs identified by PennCNV software overlapped in part with the SVS7 data, which emphasised the diversities and the shared features of the two detection methods. The GO and pathway analyses here conducted identified genes that have shown differential expression of association with production traits, carcass and meat traits, reproduction traits and growth traits in cattle. The results enrich the bovine CNVs map providing new information for association studies with economic and health-related traits of interest. Acknowledgments: This study was funded by EC-FP7/2007-2013, agreement n°222664, “Quantomics”. Authors gratefully acknowledge ANARB for the availability of semen samples and phenotypes. 1.7 REFERENCES - Bae, J. S., Cheong, H. S., Kim, L. H., Gung, S. N., Park, T. J., Chun, J. Y., Kim, J. Y., Pasaje, C. F., Lee, J. S., Shin, H. D., 2010. Identification of copy number variations and common deletion polymorphisms in cattle. BMC Genomics 11:232. - Bai, H., Sakurai, T., Someya, Y., Konno, T., Ideta, A., Aoyagi, Y., Imakawa, K., 2011. Regulation of trophoblast-specific factors by GATA2 and GATA3 in bovine trophoblast CT1 cells. J. Reprod Dev. 57(4):518-525. - Bennett, G. L., Shackelford, S. D., Wheeler, T. L., King, D. A., Casas, E., Smith, T. P. L., 2013. Selection for genetic markers in beef cattle reveals complex associations of thyroglobulin and casein1-s1 with carcass and meat traits. J Anim Sci. 91:565-571. - Bickhart, D. M., Hou, Y., Schroeder, S. G., Alkan, C., Cardone, M. F.,Matukumalli, L. K., Song, J., Schnabel, R. D., Ventura, M., Taylor, J. F., Garcia, J. F., Van Tassell, C. P., Sonstegard, T. S., Eichler, E. E, Liu, G. E., 2012. Copy number variation of individual cattle genomes using next-generation sequencing. Genome Research 22(4):778-90. !

18!

- Bionaz, M., Chen, S., Khan, M. J., Loor, J. J., 2013. Functional Role of PPARs in Ruminants: Potential Targets for Fine-Tuning Metabolism during Growth and Lactation. PPAR Res. 684159. - Colella, S., Yau, C., Taylor, J. M., Mirza, G., Butler, H., Clouston, P., Bassett, A. S., Seller, A., Holmes, C. C, Ragoussis J., 2007. QuantiSNP: an Objective Bayes HiddenMarkov Model to detect and accurately map copy number variation using SNP genotyping data. Nucleic Acids Res. 35:2013-2025. - Cooper, G. M., Nickerson, D. A., Eichler, E. E., 2007. Mutational and selective effects on copy-number variants in the human genome. Nat. Genet. 39:S22-S29. - Diskin, S. J., Li M., Hou, C., Yang, S., Glessner, J., Hakonarson, H., Bucan, M., Maris, J. M., Wang, K., 2008. Adjustment of genomic waves in signal intensities from wholegenome SNP genotyping platforms. Nuc. Acid. Res. 36:19 e126 - Fadista, J., Thomsen, B., Holm, L. E., Bendixen, B. M. C., 2010. Copy Number Variation in the Bovine Genome. Genomics 11:284 - Fernández, M., Goszczynski, D., Prando, A., Peral-García, P., Baldo, A., Giovambattista, G., Liron, J., 2014. Assessing the association of single nucleotide polymorphisms in thyroglobulin gene with age of puberty in bulls. J Anim Sci Tech. 56:17. - Fontanesi, L., Beretti, F., Riggio, V., Gómez González, E., Dall'Olio, S., Davoli, R., Russo, V., Portolano, B. 2009. Copy number variation and missense mutations of the agouti signaling protein (ASIP) gene in goat breeds with different coat colors. Cytogenet. Genome Res. 126:333-347 - Huang, Y. Z., Zhang, E. P., Chen, H., Wang, J., Li, Z. J., Huai, Y. T., Ma, L., Lan, X. Y., Ren. G., Lei, C. Z., Fang, X. T., Wang, J. Q., 2010. Novel 12-bp deletion in the coding region of the bovine NPM1 gene affects growth traits. J Appl Genet. 51(2):199-202. - Hou, Y., Liu, G. E., Bickhart, D. M., Cardone, M. F., Wang, K., Kim, E., Matukumalli, L. K., Ventura, M., Song, J., VanRaden, P. M., Sonstegard, T. S., Van Tassell, C. P., 2011. Genomic characteristics of cattle copy number variations. BMC Genomics 12:127. - Hou, Y., Bickhart, D. M., Hvinden, M. L., Li, C., Song, J., Boichard, D. A., Fritz, S., Eggen, A., DeNise, S., Wiggans, G. R., Sonstegard, T. S., Van Tassell, C. P., Liu, G. E., 2012. Fine mapping of copy number variations on two cattle genome assemblies using high density SNP array. BMC Genomics 13:376. - Jiang, L., Jiang, J., Yang, J., Liu, X., Wang, J., Wang, H., Ding, X., Liu, J., Zhang, Q., 2013. Genome-wide detection of copy number variations using high-density SNP genotyping platforms in Holsteins. BMC Genomics 27;14:131. !

19!

- Lewandowska-Sabat, A.M., Boman, G.M., Downing, A., Talbot, R., Storset, A.K., Olsaker, I., 2013. The early phase transcriptome of bovine monocyte-derived macrophages infected with Staphylococcus aureus in vitro. BMC Genomics 14:891. - Liu, G. E., Hou, Y., Zhu, B., Cardone, M. F., Jiang, L., Cellamare, A., Mitra, A., Alexander, L. J., Coutinho, L. L., Dell'Aquila, M. E., Gasbarre, L. C., Lacalandra, G., Li, R. W., Matukumalli, L.K., Nonneman, D., Regitano, L. C., Smith, T. P., Song, J., Sonstegard, T. S, Van Tassell, C. P., Ventura M., Eichler, E. E., McDaneld, T.,G., Keele, J. W., 2010. Analysis of copy number variations among diverse cattle breeds. Genome Res. 20:693703. - Matukumalli, L. K., Lawley, C. T., Schnabel, R. D., Taylor, J. F., Allan, M. F., Heaton, M. P., Connell, J., Moore, S. S., Smith, T. P., Sonstegard, T. S., Van Tassell, C. P., 2009. Development and characterization of a high density SNP genotyping assay for cattle. PLoS One 4:e5350. - Meyers, S. N., McDaneld, T. G., Swist, S. L., Marron, B. M, Steffen, D. J., O'Toole, D., O'Connell, J. R., Beever, J. E, Sonstegard, T.,S, Smith, T. P., 2010. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. BMC Genomics 27;11:337. - Pinto, D., Darvishi, K., Shi, X., Rajan, D., Rigler, D., Fitzgerald, T., Lionel, A. C., Thiruvahindrapuram, B., Macdonald, J. R., Mills, R., Prasad, A., Noonan, K., Gribble, S., Prigmore, E., Donahoe, P. K., Smith, R. S., Park, J. H., Hurles, M. E., Carter NP, Lee C, Scherer SW, Feuk L., 2011. Comprehensive assessment of array-based platforms and calling algorithms for detection of copy number variants. Nat. Biotechnol. 29(6):512-20. - Quinlan, A. R., Hall, I. M., 2010. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26(6):841-2. - Redon, R., Ishikawa, S., Fitch, K. R., Feuk, L., Perry, G. H., Andrews, T. D., Fiegler, H., Shapero, M. H., Carson, A. R., Chen, W., 2006. Global variation in copy number in the human genome. Nature 444: 444–454. - Ren, G., Liu, J. X., Li, F., Lan, X. Y., Li, M. J., Zhang, Z. Y., Chen, H., 2011. A novel missense mutation of bovine lipase maturation factor 1 (LMF1) gene and its association with growth traits. African J Biotech. 10(39):7562-7566. - Rosengren Pielberg, G., Golovko, A., Sundstrom, E., Curik, I., Lennartsson, J., Seltenhammer, M. H., Druml, T., Binns, M., Fitzsimmons, C., Lindgren, G., Sandberg, K., Baumung, R., Vetterlein, M., Strömberg, S., Grabherr, M., Wade, C., Lindblad-Toh, K., Pontén, F., Heldin, C. H., Sölkner, J., Andersson, L., 2008. A cis-acting regulatory !

20!

mutation causes premature hair graying and susceptibility to melanoma in the horse. Nat. Genet. 40:1004-1009. - Schaschl, H., Aitman, T. J., Vyse, T. J., 2009. Copy number variation in the human genome and its implication in autoimmunity. Clin. Exp. Immunol. 156:12-16. - Seroussi, E., Glick, G., Shirak, A., Yakobson, E., Weller, J. I., Ezra, E., Zeron, Y., 2010. Analysis of copy loss and gain variations in Holstein cattle autosomes using BeadChip SNPs. BMC genomics 11: 673 - Sha, B. Y., Yang, T. L., Zhao, L. J., Chen, X. D., Guo, Y., Chen, Y., Pan, F., Zhang, Z. X., Dong, S. S., Xu, X. H., Deng, H.W., 2009. Genome-wide association study suggested copy number variation may be associated with body mass index in the Chinese population. J Hum Genet. 54(4):199-202. - Sun, W., Wright, F. A, Tang, Z., Nordgard, S. H., Van Loo, P., Yu, T., Kristensen, V. N., Perou, C. M., 2009. Integrated study of copy number states and genotype calls using highdensity SNP arrays. Nucleic Acids Res. 37(16):5365-77. - Tam, G. W., Redon, R., Carter, N. P., Grant, S. G., 2009. The role of DNA copy number variation in schizophrenia. Biol. Psychiatry 66:1005-1012. - Tsuang, D. W., Millard, S. P., Ely, B., Chi, P., Wang, K., Raskind, W. H., Kim, S., Brkanac, Z., Yu, C. E., 2010. The effect of algorithms on copy number variant detection. PLoS One 5:e14456. - Xu, L., Hou, Y., Bickhart, D. M., Song, J., Liu, G. E., 2013. Comparative Analysis of CNV Calling Algorithms: Literature Survey and a Case Study Using Bovine High-Density SNP Data. Microarrays 2(3): 171-185. - Wain, L. V., Armour, J. A. L., Tobin, M. D., 2009. Genomic copy number variation, human health, and disease. Lancet. 374:340–50. - Wang, K., Li, M., Hadley, D., Liu, R., Glessner, J., Grant, S. F., Hakonarson, H., Bucan, M., 2007. PennCNV: an integrated hidden Markov model designed for high-resolution copy number variation detection in whole-genome SNP genotyping data. Genome Res. 17:1665-1674. - Wang, H., Jiang, L., Liu, X., Yang, J., Wei, J., Xu, J., Zhang, Q., Liu, J. F., 2013.A postGWAS replication study confirming the PTK2 gene associated with milk production traits in Chinese Holstein. PLoS One 8(12):e83625. - Wang, J, Jiang J., Fu, W., Jiang, L., Ding, X., Liu, J. F., Zhang Q., 2012. A genome-wide detection of copy number variations using SNP genotyping arrays in swine. BMC Genomics 13:273 !

21!

- Wang, K., Li, M., Hadley, D., Liu, R., Glessner, J., Grant. S. F., Hakonarson, H., Bucan, M., 2007. PennCNV: an integrated hidden Markov model designed for high-resolution copy number variation detection in whole-genome SNP genotyping data. Genome Res. 17:1665-1674 - Winchester, L., Yau, C., Ragoussis, J., 2009. CNVdetection methods for SNP arrays. Brief Funct. Genomic Proteomic 8(5):353-66. - Wright, D., Boije, H., Meadows, J. R., Bed'hom, B., Gourichon, D., Vieaud, A., TixierBoichard, M., Rubin, C. J, Imsland, F., Hallböök, F., Andersson, L., 2009. Copy number variation in intron 1 of SOX5 causes the Pea-comb phenotype in chickens. PLoS Genet. 5(6):e1000512 - Zhang, B., Peñagaricano, F., Driver, A., Chen, H., Khatib, H. 2011. Differential expression of heat shock protein genes and their splice variants in bovine preimplantation embryos. J. Dairy Sci. 94(8):4174-4182. - Zhang, F., Huang, J., Li, Q., Ju, Z., Li, J., Shi, F., Zhong, J., Wang, C., 2010. Novel single nucleotide polymorphisms (SNPs) of the bovine STAT4 gene and their associations with production traits in Chinese Holstein cattle. African J Biotech. 9: 4003-4008. - Zhang, X., Wang, C., Zhang, Y., Ju, Z., Qi, C., Wang, X., Huang, J., Zhang, S., Li, J., Zhong, J., Shi, F., 2014 Association between an alternative promoter polymorphism and sperm deformity rate is due to modulation of the expression of KATNAL1 transcripts in Chinese Holstein bulls. Anim. Genet. 45(5):641-51.

!

22!

Figure1. Graphical representation of CNVs visualized by HD-CNV software.

Detailed legend. Each graph represents CNVs identified by PennCNV and SVS7 software for each of the 29 bovine autosomes. The size of the graphical representation of each chromosome depends on their total length. Each note represents a CNV, and edges are added between nodes that share 40% (default) overlap. The darker the red spots the more overlapping of CNVs across samples. The blue spots identify the unique events.

!

23!

Table 1. Descriptive statistics for CNVs identified with PennCNV and SVS7 software. Copy Number Min Max Mean Median Total Length number of events Length Length PennCNV* 0 97 311345.2 245646.2 30200500 46665 1053143 1 2086 159066.4 134534.5 331711379 40374 1688267 3 2915 488559.5 385138.7 1423739019 41449 4457756 4 1 511301.5 511301.5 511301 511301 511301 Total 5,099 SVS7** Loss 94830.3 57612.5 72260727 11315 1440751 762 Gain 80324.2 37591.4 42330968 20342 770044 527 Total 1,289 *0 = homozygous deletion, 1 heterozygous deletion, 3 heterozygous duplication, and 4 homozygous duplication **loss= homozygous or heterozygous deletion; gain= homozygous or heterozygous duplication

Table 2. Descriptive statistics for CNVRs identified with PennCNV and SVS7 softwares. Number Total Min Max CNVRs Mean Median of events Length Length Length PennCNV* Loss 210454.3 148427.5 46299963 40754 977685 220 Gain 596255.2 403827.3 461501583 45465 3873856 774 Complex** 1625208.1 1068260.7 173897266 179707 6703707 107 210454.4 148427.5 46299963 40754 977685 Total 1,101 SVS7* Loss 116378.6 61523.6 21530044 11314 1440750 185 Gain 115358.1 83498.5 6460049 20341 460833 56 Complex** 158863.1 127525.5 5719073 21916 770043 36 Total 277 *loss= homozygous or heterozygous deletion; gain= homozygous or heterozygous duplication **complex= CNVRs defined both as deletion and duplication across samples

!

24!

Table 3. Comparison between results of this study and results from literature.

Results from different studies Reference Bae et al. (2010) Hou et al. (2011) Jian et al. (2013) Liu et al. (2010) Fadista et al. (2010) Bickhart et al. (2012) This study

!

Methods of detection SNP-based Studies (54k) SNP-based Studies (54K) SNP-based Studies (HD) CGH-based Studies CGH-based Studies Resequencing-based Studies SNP-based Studies (54k)

Total N° CNVRs samples

Breeds

Lenght (Mb)

Overlapped CNVRs of this study Total Percentage Count length overlap (Mb)

368

265

1

63.1

13

8,7%

4.1

682

521

21

158.0

57

38,0%

22.4

367

96

1

42.7

15

10,0%

0.92

177

90

17

28.1

3

2,0%

1.3

304

20

4

22.0

4

2,7%

1.3

1,265

5

3

55.6

12

8,0%

2.3

150

17.1

25!

Table 4. Common CNVRs in the Brown Swiss breed between Hou et al. (2011) and this study. Hou et al. (2011) (UMD3.1 This study (UMD3.1 assembly) assembly) PennCNV PennCNV start bta CNVR 2 8788219

bta 2

start CNVR 8788219

end CNVR 9113368

lenght CNVR 325150

9

4305338

4386831

81494

9

12

31368562 31679957

311396

12 30099199 31555734 1456535 30751141 30912583

Longissimus muscle area (11733)

14

17378950 17457836

78887

14 17322658 17457836

Calving ease (maternal) (10958) Longissimus muscle area (4550) Shear force (20791)

18

57565406 57659303

93898

18 56364657 58090087 1725430 55181080 55181080 55181080 55181080 55777394

4050528

end CNVR 9040720

lenght CNVR 252501

4476378

425850

135178

start QTL

end QTL

trait (ID)

9003563

9867063

trans-15-C18:1 fatty acid content (20510)

2148415

9159784

Interval from first to last insemination (5006)

9884020 19204282 12169925 20562022 16752147 18440442 60030732 60030732 60030732 60030732 55928978

55860765 63144054 56701305 56852890

!

QTL

Stillbirth (direct) (15198), (15199) Birth index (15200) Calving ease (direct) (15201) (15202) Calf size (direct) (15203), (15204) Marbling score (10014) Bilateral convergent strabismus with exophthalmus (10051) Dystocia (direct) (11363)

26!

Table 5. List of genes located in identified Brown Swiss CNVRs reported in literature. Consensus CNVRs Genes in Consensus CNVRs Bta 3 5 12 12 14

!

Start 7957960

References

End

Start

End

Ensembl code

Gene symbol

7983149

7928113

7944607

ENSBTAG00000021842

FCGR2B

ENSBTAG00000008063 ENSBTAG00000009340 ENSBTAG00000034785 ENSBTAG00000009578

PPARα KATNAL1 DNAJC15 PTK2

116895329 117247824 117151549 117233112 30418611 30646042 30519852 30558210 13179696 13204137 13183734 13266310 3885798 4017201 3870893 4065010

14

9300228

9345140

9262251

9508938

ENSBTAG00000007823

TG

19 19 19 20 22 25 26

42976859 42976859 42976859 2880532 59951940 609241 25828973

43170256 43170256 43170256 3189118 60243916 983759 25982293

43056660 42960226 43033597 3111198 60016985 724446 25856475

43132624 42996671 43054075 3123860 60024586 775899 25865594

ENSBTAG00000021523 ENSBTAG00000010125 ENSBTAG00000009496 ENSBTAG00000015316 ENSBTAG00000019707 ENSBTAG00000019745 ENSBTAG00000017710

STAT3 STAT5B STAT5A NPM1 GATA2 LMF1 ECHS1

Lewandowska-Sabat et al. (2013) Bionaz et al. (2013) Zhang et al. (2014) Zhang et al. (2011) Wang et al. (2013) Fernàndez et al. (2014) Bennet et al. (2013) Zhang et al. (2010) Huang et al. (2010) Bai et al. (2011) Ren et al. (2011) Strillacci et al. (2014)

27!

Supplementary Files Supplementary File 1: List of the copy number variant regions (CNVRs) identified using PennCNV and SVS7 software and the consensus CNVRs (PennCNV/SVS7) generated according to Wain et al. (2009).

chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 !

pennCNV (CNVRs) 1359951 1603944 1625471 2013659 4727118 5010974 5319965 5741816 12889396 13019983 17021138 17160556 18170722 18980052 19829143 20192420 27357510 27761036 28034525 28216247 41315418 41465449 43317853 43861492 46321775 46648008 47389301 49230292 52191701 52316632 56505444 56901848 60753573 61329180 66188527 66630647 68066718 69250962 71229187 71623173 72573950 73640200 80875014 80974985 81018906 81160609 82059960 82468782 83030921 83672872 88086502 88262684 91031267 91358383 92958471 93279488 95793312 95910972 97276664 97484342 101103098 101366448 101403755 101664632 101773849 102056710 103728420 103926075 104842361 105264358 106228836 106295981 106512965 106824629 107094743 107172243 108154057 108782509 109649036 109869888 113631332 113780811

lenght 243993 388188 283856 421851 130587 139418 809330 363277 403526 181722 150031 543639 326233 1840991 124931 396404 575607 442120 1184244 393986 1066250 99971 141703 408822 641951 176182 327116 321017 117660 207678 263350 260877 282861 197655 421997 67145 311664 77500 628452 220852 149479

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr13 chr13

pennCNV (CNVRs) 2058297 2273370 2814820 3705325 9079069 9165632 13140896 13273888 15726574 16098884 18472407 18584913 20079121 20402284 20510073 20800774 21073393 21441958 22664255 22863845 25141005 25255436 27006686 27133552 29520358 29778424 30099199 31555734 31639399 31848902 34480373 34635671 35189028 35703502 41384223 41479027 45002070 45573176 47300401 47528422 48758328 49421215 50125707 50324576 52546816 52663318 55097796 55674695 55867003 56204081 56367819 56695055 57077252 57211328 57931622 58461348 63969950 64152261 64384089 64761912 66068259 66877440 69969069 70092297 77109094 77347204 78099072 78212571 78276736 78750520 81184160 81586853 83477477 83777475 87579030 87891233 88638167 90826206 1247948 1912749 2823073 5324891

lenght 215073 890505 86563 132992 372310 112506 323163 290701 368565 199590 114431 126866 258066 1456535 209503 155298 514474 94804 571106 228021 662887 198869 116502 576899 337078 327236 134076 529726 182311 377823 809181 123228 238110 113499 473784 402693 299998 312203 2188039 664801 2501818 28!

chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 !

114945541 115389278 117619160 118532290 120915343 123921894 126070556 127491286 128320901 131423039 132497074 135194234 138583183 139409122 141903958 145470565 146862570 147121098 147255491 148684318 149101763 149969397 150900517 152189521 155654021 157039952 904065 1795004 4087123 4587203 6645590 8788219 12533969 12789975 14496313 15972368 17627839 23334606 25359234 26781358 28376835 32056065 39976359 52966242 55118828 56123710 56504541 57260012 59569007

115185215 115456741 118226740 118882592 121003901 124196948 126846004 127749327 129505485 132312674 132647596 136476195 138832098 139590378 145280015 146632014 147076679 147195759 148388848 148841496 149335782 150574361 151929994 155224721 156710174 157328169 1247436 1982197 4165880 5601419 6831955 9040720 12632490 12954788 14565726 16087638 17830735 23405887 25826013 28215944 28573158 32376219 40021512 53016506 55566541 56267092 56636575 57449775 59927024

239674 67463 607580 350302 88558 275054 775448 258041 1184584 889635 150522 1281961 248915 181256 3376057 1161449 214109 74661 1133357 157178 234019 604964 1029477 3035200 1056153 288217 343371 187193 78757 1014216 186365 252501 98521 164813 69413 115270 202896 71281 466779 1434586 196323 320154 45153 50264 447713 143382 132034 189763 358017

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr13 chr14 chr14 chr14 chr14 chr14 chr14 chr14

9139641 9424085 12587622 13067288 14356314 14585745 15923779 18657767 21363395 25212012 30108205 31580781 33141153 34808642 35563916 36079542 36730055 38086947 38943133 41414256 44847602 45381514 51732402 53890455 55288364 58836000 60468277 61426148 62534909 66774859 69042143 70860749 71860088 73478012 73746516 74078322 76330479 77022083 78148257 78705310 79866776 83520405 1435005 3885798 6850767 8385937 10586742 13146789 17322658

9276071 10663054 12759014 13907892 14509110 15088689 16424596 19388240 21676028 25818921 30337948 31876709 34047662 35148331 35875350 36576754 37334004 38618369 41366870 44168398 45158832 47680091 52065761 54829615 56292896 59223837 60781323 61782627 63500701 68766380 69187742 71713558 73230677 73681829 73866335 74436097 76932968 77956325 78501277 79775537 82559505 83662585 3664511 6371334 8264685 10549180 12151878 13680187 17457836

136430 1238969 171392 840604 152796 502944 500817 730473 312633 606909 229743 295928 906509 339689 311434 497212 603949 531422 2423737 2754142 311230 2298577 333359 939160 1004532 387837 313046 356479 965792 1991521 145599 852809 1370589 203817 119819 357775 602489 934242 353020 1070227 2692729 142180 2229506 2485536 1413918 2163243 1565136 533398 135178 29!

chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 !

63411488 65044427 65469391 70665916 70978502 71848377 76112733 79017908 82707674 83008944 90155450 93065483 103864593 105666691 106526130 109740844 112515240 114112197 115475433 119450394 122409628 125653839 126957475 128251331 128947842 132921343 133504852 970386 3050190 5505466 6900453 7866803 9579325 13635591 13974787 14791163 21371931 23409559 26394698 26738133 29187683 29852694 30963937 31331920 33276539 35046094 39097420 39456939 40263643

64300614 65249007 65700940 70895063 71382630 73436684 76563133 79414331 82808175 83050544 90355514 93172942 104026376 105958636 108549488 110393192 112756530 114317194 116087072 120251367 124922135 125716884 127860492 128695085 132821698 133258339 136531159 1223441 3320855 5552259 7052779 8021336 9751086 13842528 14321565 17319185 22326368 23534653 26438136 28144691 29381184 30194236 31131027 31750523 34344799 35317787 39143931 39599273 40364628

889126 204580 231549 229147 404128 1588307 450400 396423 100501 41600 200064 107459 161783 291945 2023358 652348 241290 204997 611639 800973 2512507 63045 903017 443754 3873856 336996 3026307 253055 270665 46793 152326 154533 171761 206937 346778 2528022 954437 125094 43438 1406558 193501 341542 167090 418603 1068260 271693 46511 142334 100985

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15

17674401 20089569 21037828 24482969 25254540 27669598 34046332 35554436 38344250 39201271 40484309 46959846 48614875 50323759 51457342 53415847 56053388 58262807 60333729 61792567 63431800 65147770 69028708 70358208 77123730 77900043 79178022 80475984 83306326 83685686 1492400 5001246 12027285 13154168 15595454 16937958 21325465 23188415 24673090 25535567 25925175 29305818 30573210 32044715 33565804 34171356 37027165 37149431 41707747

18296407 20635979 22226073 24787245 25501417 27875890 34189618 35744766 38789482 39907342 40646356 47141282 48929525 50680387 51540635 54164119 57510609 58740723 61100170 61965465 63695912 65511994 70003286 70763413 77222049 78092917 79486476 81414515 83504134 83773615 1676811 5134162 12520480 13226449 16042857 17080803 22026329 23448971 24930212 25719311 26790090 29448587 31873933 32395964 33698965 35252207 37107956 38251520 41971248

622006 546410 1188245 304276 246877 206292 143286 190330 445232 706071 162047 181436 314650 356628 83293 748272 1457221 477916 766441 172898 264112 364224 974578 405205 98319 192874 308454 938531 197808 87929 184411 132916 493195 72281 447403 142845 700864 260556 257122 183744 864915 142769 1300723 351249 133161 1080851 80791 1102089 263501 30!

chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 !

40903270 42791404 49544712 51126976 69716313 75364755 76367708 77923168 78971559 79353705 79652820 80889108 82623974 85100892 85629524 86762502 87904203 91703200 94758229 97132442 98123394 100442675 101253585 101785952 103021431 104093652 104716951 107362756 108257297 111214429 112203165 113271662 114451860 115630359 118934229 120191150 4258236 6248795 7779209 10528978 10967124 15645122 18447308 25373005 28413603 29449548 34794353 36408463 37145925

41432313 42893462 49766904 52402934 69968011 75413638 76821191 78108702 79333053 79581142 79777779 81630254 82677195 85450050 85860004 87293789 88170287 93847303 94980177 97923006 99655499 100982336 101377479 101942771 103358134 104249570 105536719 108033653 110293079 111547601 112286655 114220425 115236331 118715700 119113936 120860510 5312990 6337362 8466191 10933419 11215149 15947178 18689580 25646689 29123987 29602230 34856797 36928225 37631099

529043 102058 222192 1275958 251698 48883 453483 185534 361494 227437 124959 741146 53221 349158 230480 531287 266084 2144103 221948 790564 1532105 539661 123894 156819 336703 155918 819768 670897 2035782 333172 83490 948763 784471 3085341 179707 669360 1054754 88567 686982 404441 248025 302056 242272 273684 710384 152682 62444 519762 485174

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr15 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr17 chr17 chr17 chr17 chr17

43308530 44417808 45634800 46906029 52590087 53250782 54617640 57260972 58628094 61958209 65590902 67185489 75482866 76265233 77046320 78230054 78544866 81335502 900145 2134973 3987821 6146432 8486467 9883787 12130589 13695211 24241296 27248557 29441057 30466202 32341971 45083406 46069918 46509837 49355913 50281187 66863251 68014396 69911268 71349209 75305757 77098989 78939515 80351106 1041832 2881443 4217941 5792606 8776227

43652444 44584661 46058920 47196374 53166998 53459520 54939673 57592823 59434020 62309986 66483616 68123068 76166896 76598267 77451913 78401390 78681531 82335513 1104865 3621602 4610955 6494072 8769236 10805391 12365230 14500474 24401108 27432134 29661958 30885863 32837610 45425579 46213318 48879755 49491331 52535473 67192692 68455943 71125864 74046418 76681045 78356180 79896422 80924801 2084655 3228062 4675045 6436523 9027765

343914 166853 424120 290345 576911 208738 322033 331851 805926 351777 892714 937579 684030 333034 405593 171336 136665 1000011 204720 1486629 623134 347640 282769 921604 234641 805263 159812 183577 220901 419661 495639 342173 143400 2369918 135418 2254286 329441 441547 1214596 2697209 1375288 1257191 956907 573695 1042823 346619 457104 643917 251538 31!

chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 !

38166835 41556810 44792807 45835326 47137606 47821591 48615363 50300237 55594630 58512174 60521073 63420711 66583105 68942061 69955754 70839756 72920828 73699663 73861517 76868216 78440044 80154498 83897939 85983005 86324014 92235197 93211337 94760042 95336471 96034920 99542142 100289958 103231866 106276208 106885171 107416505 108867683 111788712 114396713 115713661 117170573 3180610 10969920 11647027 19128124 22943453 27973786 33953799 34371932

38548833 41657868 45202155 45904319 47396270 47949379 48726071 50547931 55687238 58998553 60917347 63674872 66978951 69220543 70729858 70931951 73085109 73791282 74266771 77839843 78523846 80407501 84274238 86286457 86480802 92436001 93739544 94973039 95465677 97128968 99635737 101072503 103687583 106404042 107060437 107732347 108974924 113614764 114688732 116485311 120412745 3434356 11526654 11800467 19594448 23171537 28024945 34325053 34446901

381998 101058 409348 68993 258664 127788 110708 247694 92608 486379 396274 254161 395846 278482 774104 92195 164281 91619 405254 971627 83802 253003 376299 303452 156788 200804 528207 212997 129206 1094048 93595 782545 455717 127834 175266 315842 107241 1826052 292019 771650 3242172 253746 556734 153440 466324 228084 51159 371254 74969

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18

9206816 10140780 11169306 14357124 16758551 18186024 19109434 23322903 24320366 27416064 30676454 31310645 32731007 39963957 42425636 44413031 45356254 47170772 48479069 49531815 53180044 54312738 55366744 55713369 56963536 59778912 60418182 62070942 63515768 64912981 68468706 70290307 72987826 1094150 1875406 4899308 34379769 35971459 39793889 42638878 43327273 45870264 46552279 47259533 47627016 48960277 51321651 52664641 53132012

9558819 10557794 11231535 14596438 16985065 19008492 19315294 23431642 24539327 27516228 30949325 31790508 32964041 40071626 42688661 44616245 46814289 48276271 48788398 49828442 54052291 54945167 55658355 55941040 57203284 60165864 60746006 63480469 63753770 68253146 69360236 72741339 74598498 1751859 2793266 6776532 35085008 36040190 42136113 42826428 44064689 46373028 46972002 47443804 47983685 49167271 52024379 52739093 53224638

352003 417014 62229 239314 226514 822468 205860 108739 218961 100164 272871 479863 233034 107669 263025 203214 1458035 1105499 309329 296627 872247 632429 291611 227671 239748 386952 327824 1409527 238002 3340165 891530 2451032 1610672 657709 917860 1877224 705239 68731 2342224 187550 737416 502764 419723 184271 356669 206994 702728 74452 92626 32!

chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr5 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 !

34896625 42166749 46132243 51141012 60556520 65922088 69351812 69856333 72938296 73976636 74778313 75002613 76599679 76724602 85160180 95459836 96623157 97828652 103539042 105275043 106713645 107840177 108811739 113250833 114543256 115010779 117738204 496589 1125213 2245446 7363787 9914189 10424905 12558447 13211945 13475512 14851230 15580216 17282916 19769454 20924952 23148412 24184712 25033485 25474941 30694723 39069719 40893067 42493184

35300909 42436216 46306149 51604559 60711494 66577741 69571158 70258225 73334655 74593114 74921819 75627333 76659850 77702287 85672503 95666368 97593586 98753414 104230386 105387546 107704991 107984945 111930616 113874131 114859696 117247824 120783915 643965 1641898 2642053 7902806 10295237 11363207 12846571 13417489 13610388 15252879 15808841 17563402 19996175 21126480 23217855 24764626 25356965 25925916 31067604 39753141 42446118 42866573

404284 269467 173906 463547 154974 655653 219346 401892 396359 616478 143506 624720 60171 977685 512323 206532 970429 924762 691344 112503 991346 144768 3118877 623298 316440 2237045 3045711 147376 516685 396607 539019 381048 938302 288124 205544 134876 401649 228625 280486 226721 201528 69443 579914 323480 450975 372881 683422 1553051 373389

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20

53970861 55309510 56121920 56364657 61095214 61920892 63029071 1664089 2484709 5057128 6822436 8052163 11049355 13492031 14274648 20439349 21388415 22038801 24917540 27529791 30220186 30834957 33533491 34371541 37732974 42089455 42393606 43295532 43610147 46396064 47270773 48368103 48630588 49727374 50087148 51148913 53038373 59817808 61753819 808587 1627053 2880532 5478758 6360647 7327625 8164878 8636338 9919863 10738152

54765715 55892476 56319394 58090087 61597742 62751093 64901743 1903390 3247474 5718616 7273862 9417473 12032389 13634621 17923922 20635700 21733030 23650335 26039760 27602402 30572014 31226718 33811153 36710214 38018129 42352691 43170256 43441993 46202442 46770465 47725481 48449016 48801884 49826620 50567992 52911677 59742080 61550668 62986532 861460 2585844 5096097 6029026 6416157 7409378 8539206 9028131 10295382 10871544

794854 582966 197474 1725430 502528 830201 1872672 239301 762765 661488 451426 1365310 983034 142590 3649274 196351 344615 1611534 1122220 72611 351828 391761 277662 2338673 285155 263236 776650 146461 2592295 374401 454708 80913 171296 99246 480844 1762764 6703707 1732860 1232713 52873 958791 2215565 550268 55510 81753 374328 391793 375519 133392 33!

chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 !

43037439 44305092 45479538 46970861 56952870 60654151 63996365 66307093 66747934 69979797 76696893 77228984 79766485 79942163 81467492 82128469 84819700 91984771 94562464 98198721 99187864 100428424 100903198 101357896 101749615 104453601 106197672 110697360 113157379 114747565 117013231 118004635 1127439 2565484 7822111 7986664 13279972 14330447 17490481 18707985 18910887 19352717 21462645 24233634 24946051 26984291 27973088 33658873 34534432

43614199 44894050 46178717 47188068 57139728 61132085 64542255 66594604 66802712 70123449 76754229 77520815 79817258 79982917 81604925 82480772 84996399 92242383 95080255 98363600 99408048 100827998 101297489 101661011 101983370 105309108 110591345 111110390 113606872 115490762 117148273 118986727 2008771 6669157 7910128 8315512 13823591 14434623 18476120 18845261 19084659 21347602 23074262 24778430 25232158 27258897 28567404 34011987 34709657

576760 588958 699179 217207 186858 477934 545890 287511 54778 143652 57336 291831 50773 40754 137433 352303 176699 257612 517791 164879 220184 399574 394291 303115 233755 855507 4393673 413030 449493 743197 135042 982092 881332 4103673 88017 328848 543619 104176 985639 137276 173772 1994885 1611617 544796 286107 274606 594316 353114 175225

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21 chr21

17710059 18099389 23843046 28186842 29684981 37066726 37777328 40728408 42696358 48715588 50128719 51044020 52816141 53798275 55865295 56662612 58071204 60902173 62247834 63356077 64754802 65715521 67462559 69020321 69554351 2749974 7022598 10788801 13052680 14362108 14723518 19051950 22520337 26116828 26936862 28387366 28675178 30608016 33327048 35777432 37293354 42389217 46018333 47963417 49439452 49594234 52139183 56118709 57156944

17946080 19040448 23886196 28463308 30161777 37374576 38606353 41777888 43004103 49251437 50347483 51205535 53333822 54060327 56196291 57263704 59109201 60954990 62736738 63771728 65099050 67038772 68355681 69504928 71535445 3027827 8519331 11360403 13110087 14654478 15659059 22397530 23220048 26715346 28283039 28612871 29923689 30908358 35267234 36083384 37705700 42835553 46063657 48099076 49533074 50244378 52608666 56785345 58442333

236021 941059 43150 276466 476796 307850 829025 1049480 307745 535849 218764 161515 517681 262052 330996 601092 1037997 52817 488904 415651 344248 1323251 893122 484607 1981094 277853 1496733 571602 57407 292370 935541 3345580 699711 598518 1346177 225505 1248511 300342 1940186 305952 412346 446336 45324 135659 93622 650144 469483 666636 1285389 34!

chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 !

35003374 37537822 38613662 39868831 42788788 44490836 45097887 46293900 47954688 49999470 53736537 55434939 57357439 59766632 60628965 61879960 62400698 63255889 64766846 66061402 66951622 68382283 72264142 74320957 78762342 81863002 84971705 85387851 86669785 87700528 88192479 91670145 95531504 97691853 103159234 104730721 108096309 108685133 109991711 111259941 494866 1208626 8340612 10320524 21220037 23493443 27557552 27908523 28726561

35581341 38075277 39679687 41875877 43479777 44901489 46109256 47213804 48218360 50541246 54081460 55655916 57641183 60012102 61330104 61992242 62978076 63778905 65245810 66450039 67774508 68861661 72424026 74632687 78987067 82943896 85071041 85579651 86879535 87790787 88268249 91974966 95600027 98013150 103375625 105465008 108307729 109268080 110422232 111891998 1047065 1745249 8725932 11500414 21525831 24103669 27831038 28559343 29068846

577967 537455 1066025 2007046 690989 410653 1011369 919904 263672 541776 344923 220977 283744 245470 701139 112282 577378 523016 478964 388637 822886 479378 159884 311730 224725 1080894 99336 191800 209750 90259 75770 304821 68523 321297 216391 734287 211420 582947 430521 632057 552199 536623 385320 1179890 305794 610226 273486 650820 342285

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr21 chr21 chr21 chr21 chr21 chr21 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr23 chr23 chr23 chr23 chr23 chr23 chr23 chr23 chr23 chr23 chr23 chr23 chr23

58944572 59787612 61094140 65272069 67593887 70089833 632381 2808095 5022403 6814022 7623264 9918880 11756783 14086186 14514444 15589177 16219978 16437316 17882779 19409002 20826586 21963292 23268971 23834157 29101885 32990568 35771697 37590098 39545402 40167931 42177755 42791065 46902036 50705290 52706213 54440045 2570211 4083573 4622146 4781751 6948746 9951185 10526857 12910040 13770707 14063300 16601543 22716563 24803563

59248804 60553762 63286443 67220188 69554017 71136925 1428683 3126680 5353497 7263366 8838211 11246732 13223791 14300175 15177059 15974506 16342830 16727330 18494857 19588936 20920119 22075972 23458863 24538255 29655985 33583017 36047120 38303302 39702951 41573980 42616545 44030499 48406016 52187729 53254546 61040701 3664434 4455923 4737838 5233255 8124702 10240332 11251946 13155828 13866915 14981935 20402236 23507190 25507676

304232 766150 2192303 1948119 1960130 1047092 796302 318585 331094 449344 1214947 1327852 1467008 213989 662615 385329 122852 290014 612078 179934 93533 112680 189892 704098 554100 592449 275423 713204 157549 1406049 438790 1239434 1503980 1482439 548333 6600656 1094223 372350 115692 451504 1175956 289147 725089 245788 96208 918635 3800693 790627 704113 35!

chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 !

32611423 33668705 34584476 40470452 41930432 47092657 47540190 48914474 50626573 52557297 54402516 55084725 56512655 58505244 58926246 59541510 60589007 61877938 62469487 63435892 65228923 65960156 66721299 68168243 68689710 69285264 71263375 73238931 76005495 76530816 79314073 80944503 82099108 84780381 85645138 88545459 89619126 90412852 94115663 94579362 96266647 97543154 100873051 101446930 102608032 104220117 105486423 107107709 108492195

32749041 33771490 35464882 41173061 42545530 47224522 47898948 49550836 50938776 53980316 54894631 55239532 56625850 58729476 59487308 60071322 61042106 62108589 62575787 63956656 65659020 66134324 67180774 68442169 68850097 69622989 71627282 73435613 76281603 76620508 79817203 81334383 82223990 84896726 86810388 89313850 90249304 91278924 94386951 95277410 96712245 98056575 101206057 101529840 103188091 105033919 106196262 107324529 108868929

137618 102785 880406 702609 615098 131865 358758 636362 312203 1423019 492115 154807 113195 224232 561062 529812 453099 230651 106300 520764 430097 174168 459475 273926 160387 337725 363907 196682 276108 89692 503130 389880 124882 116345 1165250 768391 630178 866072 271288 698048 445598 513421 333006 82910 580059 813802 709839 216820 376734

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr23 chr23 chr23 chr23 chr23 chr23 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr25 chr25 chr25 chr25 chr25 chr25 chr25 chr25 chr25 chr25

27174246 27776075 37292633 40182681 45009074 46578332 541784 1450456 3237803 5828401 7322657 11753230 12775555 14841074 17317994 19267711 21571435 24302542 28175885 28400451 28853585 32346216 34621317 36301805 39320770 41289711 42296195 45239241 47722933 48140670 48528178 49755342 52047342 53328928 55570429 56379984 56834044 57257505 60394194 472458 5662943 9252279 12965823 14216892 15006757 15365566 17363060 17891876 18372002

27583474 28311070 37692330 42669248 45666148 51938161 1094942 2859956 5054955 6047561 7943787 11888700 12916861 15259118 17513135 19370939 22300490 24582206 28218879 28546447 29405619 34201179 36201079 36566389 39365195 41540027 43402173 47323079 47797164 48226481 48999628 50568228 52165674 53576672 55980406 56564480 56889750 59703255 62191687 5156189 7515881 10305794 13824693 14569665 15120011 16017661 17742193 18206998 18448555

409228 534995 399697 2486567 657074 5359829 553158 1409500 1817152 219160 621130 135470 141306 418044 195141 103228 729055 279664 42994 145996 552034 1854963 1579762 264584 44425 250316 1105978 2083838 74231 85811 471450 812886 118332 247744 409977 184496 55706 2445750 1797493 4683731 1852938 1053515 858870 352773 113254 652095 379133 315122 76553 36!

chr8 chr8 chr8 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr9 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 !

110455623 111668506 112020602 1926314 2434402 2779925 4050528 8858542 10343145 16768069 18790503 22281170 25126494 26179360 28887462 31510537 32343804 34681064 50378425 55532332 56966851 60280329 65284951 70248005 73259605 76776811 81195326 83692030 86288986 87008260 88342363 89847787 90807695 90996268 95127819 96131728 97260495 100022759 102546533 2244249 3229515 4415581 4742149 5767015 8132805 8675119 9558767 11654004 11998905

111180295 111713971 112966306 2284075 2728202 3115242 4476378 9018195 10765698 17298279 18862613 22396640 25185694 26847057 29029183 32049723 32549297 34802818 50694137 55630797 57069740 61209187 65672050 70491698 74512290 77070363 81277154 83837068 86971466 87254861 88714313 90002616 90924836 91158204 95952795 97191669 99334002 101470808 105462864 2361595 3343140 4534148 5598788 6724993 8394690 8898592 10846884 11707725 12386269

724672 45465 945704 357761 293800 335317 425850 159653 422553 530210 72110 115470 59200 667697 141721 539186 205493 121754 315712 98465 102889 928858 387099 243693 1252685 293552 81828 145038 682480 246601 371950 154829 117141 161936 824976 1059941 2073507 1448049 2916331 117346 113625 118567 856639 957978 261885 223473 1288117 53721 387364

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr25 chr25 chr25 chr25 chr25 chr25 chr25 chr25 chr25 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr26 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27

22566179 25405137 30183716 32823036 33412423 34565592 36980815 38856905 40827689 2452597 3524161 4204767 5258082 8695518 10689379 16862899 17815724 19323674 20012464 22826271 24401843 25501890 27213271 28723721 32892811 33716256 36631883 37203584 38980475 40903566 41271740 41956121 45642121 46187669 46673561 48007359 703314 2248130 4357162 6866166 8781446 12842240 15794249 18710877 20559148 22922395 25295935 27804403 29009479

23040867 26380285 30269233 33108530 34112565 36514994 38698430 39921068 42364359 2687667 3618349 4731392 5526925 8887209 10995721 16973274 18967997 19657939 20560149 23603307 24507253 26124236 27343629 28784693 33337772 34460340 37018466 37579568 39121205 41183634 41762178 45302252 45954628 46366100 47837750 50273965 967098 2472812 5000552 6955584 8848885 15044426 16296679 19195734 21676934 23144459 25728096 28148660 29300595

474688 975148 85517 285494 700142 1949402 1717615 1064163 1536670 235070 94188 526625 268843 191691 306342 110375 1152273 334265 547685 777036 105410 622346 130358 60972 444961 744084 386583 375984 140730 280068 490438 3346131 312507 178431 1164189 2266606 263784 224682 643390 89418 67439 2202186 502430 484857 1117786 222064 432161 344257 291116 37!

chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr10 chr11 chr11 chr11 !

12486527 15051277 16460889 18041832 20322987 21571180 26406685 28070182 28508237 35828126 36946284 41389231 44694452 46486647 47309122 48837583 50213424 51502722 52933550 56285758 58028735 67290043 68324855 68963110 69311079 70894537 72658520 73798107 76604316 78044879 80910121 81788224 83241282 84096660 84951492 86036359 86868858 87684721 88673513 89717052 92695820 98420963 99103087 100804186 101521757 102544951 740136 2603799 5539221

13040145 16162053 17625573 18772359 20721372 22339193 26767851 28397659 28703125 36419341 37133985 41514241 45506957 46802159 48110941 49981642 51383075 51803725 53318692 57193699 58318595 67694539 68570791 69107598 69658256 71359437 72846830 73979984 76779458 78549784 81113308 82290325 83389165 84899748 85085819 86214669 87139659 88133750 89365394 91982227 93019985 98817467 99542820 101130681 102210987 103699875 1920092 3192673 6243988

553618 1110776 1164684 730527 398385 768013 361166 327477 194888 591215 187701 125010 812505 315512 801819 1144059 1169651 301003 385142 907941 289860 404496 245936 144488 347177 464900 188310 181877 175142 504905 203187 502101 147883 803088 134327 178310 270801 449029 691881 2265175 324165 396504 439733 326495 689230 1154924 1179956 588874 704767

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr27 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr28 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29 chr29

31000749 32488843 32724283 33400664 34036869 35024154 35900786 36342691 36935085 38109791 40210986 42055498 5123022 6334557 6626319 13424880 16783056 21762976 23969284 25899333 31130099 33240420 35668756 36504079 37272033 38961890 40957698 42551127 43088798 44056044 2522803 5348843 9020167 9850630 10872370 11988163 16131653 19200818 25219612 28523337 30428085 30827166 31899837 32516455 33249348 35051920 36761051 39930095 41552472

32184354 32671451 32889433 33788321 34166163 35734689 36285734 36592652 37479272 39688231 41049981 44148168 5965031 6547497 10044965 14091432 17374797 21872563 24175313 28205509 31197813 35412301 36300699 37052366 37433520 40191764 41239838 42831281 43877796 44153620 3074352 5452376 9454029 10393660 11753300 12241827 17796803 20146131 26293574 29768788 30638566 31693910 32238809 32944239 34118132 36669359 38015000 41264801 41664361

1183605 182608 165150 387657 129294 710535 384948 249961 544187 1578440 838995 2092670 842009 212940 3418646 666552 591741 109587 206029 2306176 67714 2171881 631943 548287 161487 1229874 282140 280154 788998 97576 551549 103533 433862 543030 880930 253664 1665150 945313 1073962 1245451 210481 866744 338972 427784 868784 1617439 1253949 1334706 111889 38!

chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11

!

6701679 7190271 8149768 9153560 10271653 15788936 20755386 22558808 24354910 27989531 28992259 30651364 31173613 36713471 38733905 46307696 51963535 54193489 60128321 63686208 67498111 73934314 75295616 77235847 80450475 82833655 87124625 89552045 90738123 91961667 92963716 93546324 94640611 95150490 99497380 99774304 105593624

6777332 7585747 8713134 9473158 10800426 15919622 20960589 23085190 26162970 28207767 29367145 31130270 31259588 37261133 39104584 47430509 52677772 54246625 60572203 64313748 68298497 74197538 76060924 79314962 80839258 82959206 89371911 89680768 90911719 92500678 93050541 93612322 94837245 99180813 99738023 104856815 106825407

75653 395476 563366 319598 528773 130686 205203 526382 1808060 218236 374886 478906 85975 547662 370679 1122813 714237 53136 443882 627540 800386 263224 765308 2079115 388783 125551 2247286 128723 173596 539011 86825 65998 196634 4030323 240643 5082511 1231783

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr29 chr29

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

42620218 45817015

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

45023665 50999092

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

2403447 5182077

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

39!

chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 !

SVS7 (CNVRs) 4626587 4648383 52748123 52772080 64501909 64525174 91066621 91435586 123825385 123921894 144134237 144190645 146587678 146632014 155835816 155955828 5757355 5802738 14525350 14565726 27489458 27724930 28215944 28246133 32108568 32154806 39976359 39999947 57373897 57416172 58772041 59143632 83029887 83050544 110311653 110353189 124137395 124204421 7957960 7983149 33514564 33741850 39097420 39118317 40977107 41079360 68402961 68432145 81379707 81411041 91910014 92190368 100468099 100493684 105715727 105739637 115888900 115937988 116781408 116801749 6248795 6337362 10401625 10450547 11472235 11500911 17902915 17978432 22093546 22180214 24087424 24150445 28384911 28413603 41444423 41657868 66781385 66830563 69158293 69220543 73699663 73791282 78440044 78523846 81497187 81554820 86811243 86948025 89850655 89921990 99574406 99691481 106980782 107007048 108168742 108198485

lenght 21796 23957 23265 368965 96509 56408 44336 120012 45383 40376 235472 30189 46238 23588 42275 371591 20657 41536 67026 25189 227286 20897 102253 29184 31334 280354 25585 23910 49088 20341 88567 48922 28676 75517 86668 63021 28692 213445 49178 62250 91619 83802 57633 136782 71335 117075 26266 29743

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr15 chr15 chr15 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr16 chr17 chr17 chr17 chr17 chr17 chr17 chr17 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr20

SVS7 (CNVRs) 47780178 47819771 76438547 76466667 80369812 81139855 4158997 4233985 8317477 8582055 9171622 9267151 9670453 9729773 15154212 15362423 22272329 22302686 29441057 29636822 36768083 36817218 41131268 41194530 49355913 49455109 68811897 68889225 70906202 71125864 8170089 8297151 20275502 20484740 27459029 27491589 32762909 32964041 39963957 40071626 42425636 42661925 55713369 55764236 3080400 3114628 35971459 36107915 42659289 42826428 50388296 50465387 51571629 51592949 53132012 53195763 60978019 61054591 61095214 61156737 61438125 61920892 63119361 63167945 6709868 6768232 11863651 11970132 34836416 34905583 35585081 35619269 38519698 38546855 42352691 42423488 42976859 43170256 46655940 46723662 50336021 50395622 51767413 51842198 52175916 52264019 54306610 54446207 55379112 55527962 56072306 56202223 56754737 56837932 1741145 1792368

lenght 39593 28120 770043 74988 264578 95529 59320 208211 30357 195765 49135 63262 99196 77328 219662 127062 209238 32560 201132 107669 236289 50867 34228 136456 167139 77091 21320 63751 76572 61523 482767 48584 58364 106481 69167 34188 27157 70797 193397 67722 59601 74785 88103 139597 148850 129917 83195 51223 40!

chr4 chr4 chr4 chr5 chr5 chr5 chr5 chr5 chr5 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr6 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr7 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr8 chr9 chr9 chr9 chr10 chr10 chr11 chr11 !

108867683 111990062 118608842 30684691 46279541 58847022 114543256 116895329 119729902 5025746 9736332 12648459 22613578 40107367 50981312 53428838 68291351 81551479 90966250 100620998 104493834 117013231 1293067 2597655 22524899 42788788 43709405 76886696 78081511 87158251 9133270 15417359 15665796 20018829 29068846 33356720 34898163 43628838 73715997 87038169 94115663 105683974 4239500 68973776 102258435 5437359 39823420 14979948 16425876

108904498 112164314 118655986 30838906 46306149 58966295 114698428 118329917 119949553 5086136 9981135 12703601 22672648 40208497 51007189 53449439 68332579 81604925 90989420 100709082 104587477 117148273 1353317 2680354 22681472 43132401 43808593 77011685 78307528 87359924 9156221 15441189 15773921 20067861 29100768 33747904 34920926 43779600 73829090 87141059 94973599 105695288 4439872 69002105 102271805 5540505 39846476 15029477 16514661

36815 174252 47144 154215 26608 119273 155172 1434588 219651 60390 244803 55142 59070 101130 25877 20601 41228 53446 23170 88084 93643 135042 60250 82699 156573 343613 99188 124989 226017 201673 22951 23830 108125 49032 31922 391184 22763 150762 113093 102890 857936 11314 200372 28329 13370 103146 23056 49529 88785

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr20 chr21 chr21 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr23 chr23 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr24 chr25 chr25 chr25 chr25 chr25 chr25 chr25 chr25 chr25

2880532 6360647 21018903 33773531 34241862 34953795 41239866 45052283 60902173 64185456 54186710 70089833 12869969 16219978 19409002 21431682 25141851 26527854 26865100 31649896 36527685 39545402 44430993 47510478 48858472 54028803 57098389 59951940 60435042 25250595 28503248 1027534 3321961 21071943 24499452 28060569 28175885 38640377 39320770 53328928 609241 7952738 12190414 16017661 18206998 19082329 22238007 24125205 37988321

3189118 6385223 21048672 33817557 34264853 34981347 41289921 45369517 60928704 64376028 54208626 71210609 12948282 16407075 19588936 21455286 25321072 26604789 26924506 31675722 36548339 39657636 44595995 47537080 49131324 54183730 57111693 60243916 60508872 25339818 28563533 1137518 3342966 21129533 24582206 28083770 28196203 38694114 39365195 53434181 983759 7992272 12217941 16048464 18372002 19145490 22320002 24228117 38142895

308586 24576 29769 44026 22991 27552 50055 317234 26531 190572 21916 1120776 78313 187097 179934 23604 179221 76935 59406 25826 20654 112234 165002 26602 272852 154927 13304 291976 73830 89223 60285 109984 21005 57590 82754 23201 20318 53737 44425 105253 374518 39534 27527 30803 165004 63161 81995 102912 154574 41!

chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr11 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr12 chr13 chr13 chr13 chr13 chr13 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14

!

33642979 46657176 72555948 84899274 88028793 93445185 101750113 105699664 13179696 20129895 30418611 41384223 43601825 50385487 55867003 57931622 59437039 67538730 70649671 78212571 82159124 82450106 5594384 58043371 65965727 70496054 80026050 2721633 3765019 6778397 8064004 8499902 9300228 20119611 30449596 50955416 51285167 53415847 54023420 75571250 76217573 79178022 80082712

33682867 46701073 72598008 84947879 88377200 93587894 101802657 105778702 13204137 20402284 30646042 41479027 43638160 50451289 55931940 58461348 59609816 67564989 72090421 78235491 82199690 82661747 5623697 58070117 66336246 70523797 80144645 2803998 4017201 6850767 8113083 8551460 9345140 20157384 30595032 50996515 51430094 53436763 54123146 76043148 76269650 79322701 80543545

39888 43897 42060 48605 348407 142709 52544 79038 24441 272389 227431 94804 36335 65802 64937 529726 172777 26259 1440750 22920 40566 211641 29313 26746 370519 27743 118595 82365 252182 72370 49079 51558 44912 37773 145436 41099 144927 20916 99726 471898 52077 144679 460833

chr25

! chr25 ! chr25 ! chr26 ! chr26 ! chr26 ! chr26 ! chr26 ! chr26 ! chr26 ! chr26 ! chr26 ! chr26 ! chr27 ! chr27 ! chr27 ! chr27 ! chr27 ! chr27 ! chr27 ! chr27 ! chr27 ! chr28 ! chr28 ! chr28 ! chr28 ! chr28 ! chr28 ! chr28 ! chr28 ! chr28 ! chr29 ! chr29 ! chr29 ! chr29 ! chr29 ! chr29 ! chr29 ! chr29 ! chr29 ! ! ! ! ! ! !

39286957 39544407 39785037 5258082 5472360 12136498 19686897 21902497 25828973 28303383 39655739 48693316 49027625 4544917 6922514 8730441 9096031 12282518 18036224 33813284 38025744 43237090 2313753 6334557 12717523 13713042 21982457 26994978 37514643 38026506 44030986 7401774 19618823 21930571 27184360 28192104 33329702 35136093 41212959 48178151

! ! !

39424763 39570754 39844749 5288263 5504271 12236803 19942669 21955137 25982293 28398156 39681664 48713332 49090826 4773381 7188361 8827679 9191858 12330184 18164172 33845584 38233675 43260976 2638563 6547497 12973750 13894573 22148051 27072121 37624697 38074472 44056044 7480356 19701179 21987120 27465875 28248785 33353664 35169599 41264801 48252404

! ! !

137806 26347 59712 30181 31911 100305 255772 52640 153320 94773 25925 20016 63201 228464 265847 97238 95827 47666 127948 32300 207931 23886 324810 212940 256227 181531 165594 77143 110054 47966 25058 78582 82356 56549 281515 56681 23962 33506 51842 74253

! ! !

42!

chr1 chr1 chr1 chr1 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr2 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr3 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr4 chr5 chr5 chr5 chr5 chr5 chr6 chr6 chr6 chr6 chr6 chr6 chr7 chr7 chr7 chr7 chr8 !

CNVRs Consensus (pennCNV/SVS7) 91066621 91358383 144134237 144190645 146587678 146632014 155835816 155955828 14525350 14565726 27489458 27724930 32108568 32154806 39976359 39999947 57373897 57416172 83029887 83050544 110311653 110353189 124137395 124204421 7957960 7983149 33514564 33741850 39097420 39118317 40977107 41079360 81379707 81411041 91910014 92190368 100468099 100493684 115888900 115937988 116781408 116801749 6248795 6337362 41556810 41657868 66781385 66830563 69158293 69220543 73699663 73791282 99574406 99635737 106980782 107007048 108867683 108904498 111990062 112164314 118608842 118655986 46279541 46306149 114543256 114698428 116895329 117247824 119729902 119949553 117738204 118329917 9914189 9981135 12648459 12703601 81551479 81604925 100620998 100709082 104493834 104587477 117013231 117148273 1293067 1353317 2597655 2680354 22524899 22681472 42788788 43132401 33668705 33747904

lenght 291762 56408 44336 120012 40376 235472 46238 23588 42275 20657 41536 67026 25189 227286 20897 102253 31334 280354 25585 49088 20341 88567 101058 49178 62250 91619 61331 26266 36815 174252 47144 26608 155172 352495 219651 591713 66946 55142 53446 88084 93643 135042 60250 82699 156573 343613 79199

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr15 chr16 chr16 chr16 chr16 chr16 chr17 chr17 chr17 chr17 chr17 chr18 chr18 chr18 chr18 chr18 chr18 chr18 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr19 chr20 chr20 chr20 chr20 chr20 chr21 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr22 chr23 chr24

CNVRs Consensus (pennCNV/SVS7) 76438547 76466667 4158997 4233985 8486467 8582055 29441057 29636822 49355913 49455109 70906202 71125864 27459029 27491589 32762909 32964041 39963957 40071626 42425636 42661925 55713369 55764236 35971459 36040190 42659289 42826428 51571629 51592949 53132012 53195763 61095214 61156737 61438125 61597742 63119361 63167945 11863651 11970132 35585081 35619269 34836416 34905583 42393606 42423488 42976859 43170256 46655940 46723662 50336021 50395622 52175916 52264019 51767413 51842198 56754737 56837932 54306610 54446207 55379112 55527962 56072306 56202223 1741145 1792368 2880532 3189118 6360647 6385223 41239866 41289921 60902173 60928704 70089833 71136925 12869969 12948282 16219978 16342830 19409002 19588936 39545402 39657636 47510478 47537080 57098389 57111693 60435042 60508872 59951940 60243916 25250595 25339818 1027534 1094942

lenght 28120 74988 95588 195765 99196 219662 32560 201132 107669 236289 50867 68731 167139 21320 63751 61523 159617 48584 106481 34188 69167 29882 193397 67722 59601 88103 74785 83195 139597 148850 129917 51223 308586 24576 50055 26531 1047092 78313 122852 179934 112234 26602 13304 73830 291976 89223 67408 43!

chr8 chr8 chr8 chr8 chr9 chr10 chr11 chr11 chr11 chr11 chr11 chr12 chr12 chr12 chr12 chr12 chr12 chr13 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14 chr14

!

34898163 94115663 94579362 105683974 4239500 5437359 46657176 88028793 93546324 101750113 105699664 13179696 20129895 30418611 41384223 55867003 57931622 80026050 2721633 3885798 8064004 8499902 9300228 20119611 53415847 54023420 79178022 80475984

34920926 94386951 94973599 105695288 4439872 5540505 46701073 88377200 93587894 101802657 105778702 13204137 20402284 30646042 41479027 55931940 58461348 80144645 2803998 4017201 8113083 8551460 9345140 20157384 53436763 54123146 79322701 80543545

22763 271288 394237 11314 200372 103146 43897 348407 41570 52544 79038 24441 272389 227431 94804 64937 529726 118595 82365 131403 49079 51558 44912 37773 20916 99726 144679 67561

! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

chr24 chr24 chr24 chr24 chr24 chr25 chr25 chr25 chr25 chr25 chr26 chr26 chr26 chr26 chr26 chr27 chr27 chr27 chr27 chr27 chr28 chr28 chr28 chr29 chr29 chr29 chr29 chr29

3321961 24499452 28175885 39320770 53328928 609241 37988321 39544407 39785037 39286957 5258082 5472360 25828973 48693316 49027625 4544917 6922514 8781446 38109791 43237090 6334557 13713042 26994978 19618823 33329702 35136093 41212959 48178151

3342966 24582206 28196203 39365195 53434181 983759 38142895 39570754 39844749 39424763 5288263 5504271 25982293 48713332 49090826 4773381 6955584 8827679 38233675 43260976 6547497 13894573 27072121 19701179 33353664 35169599 41264801 48252404

21005 82754 20318 44425 105253 374518 154574 26347 59712 137806 30181 31911 153320 20016 63201 228464 33070 46233 123884 23886 212940 181531 77143 82356 23962 33506 51842 74253

44!

Supplementary File 2: Summary of the results of the qPCR analysis of the eleven CNVRs selected after the consensus analysis in the Italian Brown Swiss breed.

CHR

PRIMER (FORWARD)

PRIMER (REVERSE)

PROBE

2 3 4 4 5 12 12 13 19 28 29 REF_BTF3

TGCATGCACACAGGAATGTTAC GACTAATGGCAAGAGCCGTGTA GCCCGGCGGACACTAAG TCCTGCCCAGATACCATATCCTT GGAGATAGGATAGAAAGAAATGGAGAAC GGACAGTCACCTCAGGATGCA GCCTGGTGTTGTCATGATGAA TGCGAAATTCTGGAAGAGGAA CAGTGAGCCAAAGCCAATCC ACATTCAGGCTGCCATTTTGT CACGGGCGCACCACTT GCTGAGACAAAGCAACTGACAGA

TGCCCCTAAGAAGGAGTCGTT AGGCAGGAACAGAAGGAGGAA CCAGCATTATGTCCTTCATCAACA CGAGGCAAGCTCTACAGGAAA ATGGGAGTGATGGAAAATTGAAG TTGCCACAAGTGAGGCTTCTC CCCGTACACTGACACCAAAGTG GGGTGCCTGGTGCAATTC AATCCAACTTGCCGGCTAGTATT GAGGCGGGATGTCACAGAAA CCCCCGATGAATGGCTATC TCGGCACCAAGCTGGTTTA

ACTCTGTTCAGCCCTTC TGAGCATGTCACTTTAA TCAGGAAGCTGTGGCCA TGGCATTCAAATCAC CACTCTTAAATTCCC AACGGTCACCTAAGAGACA TTTTGCGCTTGAAGCAG CCTGAGGACATGAAGTT CCTCCACAGGAATC TCCAATATCGTCAACCATT AGCTCCCTGCTCGAC TGCTCCCCAGCATC

*The UMD3.1 assembly was used to indicated the position of the CNVRs !

!

!

45!

!

CHR

START*

END*

LENGHT

2 3 4 4 5 12 12 13 19 28 29 REF_BTF3

63870167 7957198 6228016 73686740 58965609 58071208 67534765 53931895 2585940 2553716 5414600

64073748 7966700 6450000 73785101 59140571 58427000 67579929 53983934 2607218 2635632 5444000

203581 9502 221984 98361 174962 355792 45164 52039 21278 81916 29400

PENN CNV STATE GAIN GAIN GAIN LOSS LOSS LOSS ! GAIN LOSS ! GAIN!

CNAM CNV STATE ! GAIN ! LOSS ! LOSS LOSS ! ! LOSS

NUMBER OF SAMPLES 11 3 11 10 10 11 11 5 12 12 10

CONFIRMED SAMPLES

CONFIRMED RATE

VALIDATED

8 2 11 9 7 1 10 3 9 6 9

0,73 0,67 1,00 0,90 0,70 0,09 0,91 0,60 0,75 0,50 0,90

YES YES YES YES YES NO YES YES YES YES YES

GENE (Btau4.6.1) MGAT5 FCGR2B ZNF804B LOC787945 SIRPB1 OR5AS1 -

46!

Supplementary File 3: Annotation of copy number variant regions (CNVRs).

chr1 chr1 chr2 chr2

!

CNVRs_pennCNV 141903958 145280015 155654021 156710174 14496313 14565726 26781358 28215944

CNVRs_SVS7 144134237 144190645 155835816 155955828 14525350 14565726 27489458 27724930

CNVRs_Consensus 144134237 144190645 155835816 155955828 14525350 14565726 27489458 27724930

CNVRs State gain/loss gain/loss loss gain/loss

chr2 chr2 chr3 chr3

39976359 109740844 7866803 33276539

40021512 110393192 8021336 34344799

39976359 110311653 7957960 33514564

39999947 110353189 7983149 33741850

39976359 110311653 7957960 33514564

39999947 110353189 7983149 33741850

loss gain/loss gain gain/loss

chr3 chr3

39097420 91703200

39143931 93847303

39097420 91910014

39118317 92190368

39097420 91910014

39118317 92190368

loss gain/loss

chr3

100442675

100982336

100468099

100493684

100468099

100493684

gain/loss

chr3

115630359

118715700

115937988

gain/loss

66583105 73699663 99542142

66978951 73791282 99635737

115937988 116801749 66830563 73791282 99691481

115888900

chr4 chr4 chr4

115888900 116781408 66781385 73699663 99574406

66781385 73699663 99574406

66830563 73791282 99635737

gain loss loss

chr4

106885171

107060437

106980782

107007048

106980782

107007048

gain/loss gain/loss

120412745 114859696

112164314 118655986 114698428

112164314

117170573 114543256

111990062 118608842 114543256

111990062

chr4 chr5

114543256

114698428

gain/loss

chr5

115010779

117247824

116895329

118329917

116895329

117247824

gain/loss

116895329

118329917

117738204

118329917

gain/loss

chr5

117738204

120783915

119729902

119949553

119729902

119949553

gain/loss

chr6 chr7

81467492 1127439

81604925 2008771

81551479 1293067

81604925 1353317

81551479 1293067

81604925 1353317

gain/loss loss

chr7

2565484

6669157

2597655

2680354

2597655

2680354

gain/loss

chr7

21462645

23074262

22524899

22681472

22524899

22681472

gain/loss

chr7

42788788

43479777

42788788

43132401

42788788

43132401

gain/loss

144176745 155833805 14502890 27629813 27407917 39999717 110251546 7928113 33702816 33607139 33513768 39113552 91901853 91919532 91994928 92098624 92023811 92059023 92106927 91981619 92136670 92136706 100472063 100472499 115843770

Genes included in Consensus CNVRs 144180011 ENSBTAG00000030814 156185921 ENSBTAG00000030581 14623643 ENSBTAG00000044009 27629887 ENSBTAG00000044462 27758923 ENSBTAG00000044179 40017015 ENSBTAG00000003650 110405363 ENSBTAG00000010030 7944607 ENSBTAG00000021842 33702894 ENSBTAG00000044953 33621030 ENSBTAG00000000283 33556281 ENSBTAG00000018893 39114954 ENSBTAG00000015180 91911965 ENSBTAG00000013241 91925379 ENSBTAG00000046583 91995058 ENSBTAG00000042369 92100051 ENSBTAG00000040313 92054136 ENSBTAG00000017145 92083335 ENSBTAG00000017132 92132082 ENSBTAG00000015931 92014282 ENSBTAG00000004688 92190804 ENSBTAG00000030623 92165969 ENSBTAG00000044141 100495789 ENSBTAG00000013322 100483275 ENSBTAG00000024144 116226449 ENSBTAG00000016504

TFF2 TBC1D5 PPP1R1C bta-mir-2353 CERS6 NR4A2 EPHA4 FCGR2B bta-mir-2413 CSF1 AHCYL1 none BSND TMEM61 SNORA8 PARS2 C1orf177 TTC22 TTC4 DHCR24 none HEATR8 POMGNT1 LURAP1 none

66785266 73326980 99475015 99591042 106989816 106996940 112048065 112126680 114576427 114596006 114610664 114644629 117119385 117119640 117120188 116959716 117240033 116756235 117151549 117743264 117975282 118023267 117677522 117764821 118086468 119821435 119771356 119814028 119832293 119840726 119874457 119791795 119926286 81511554 1317088 1334566 1273635 2586101 2600732 22533096 22569683 22577243 22519686 22560008 22629692 42787986 42811931 42833645 42868129 42890345 42913832 42947455 43044539 43101693 43119732

66851245 73897041 99580189 99690829 106993917 107013515 112048217 112126805 114588012 114608640 114627819 114767260 117119458 117119712 117120270 116966318 117248391 116897163 117233112 117758670 118012354 118036020 117738845 117853214 118343833 119829363 119791795 119819426 119837101 119854120 119885052 119813398 120029002 81653990 1334619 1346051 1313897 2598115 2618482 22537819 22574912 22580777 22532977 22561849 22680307 42788915 42813032 42834607 42869064 42891283 42914770 42948392 43045551 43102628 43120670

SCRN1 ZNF804B CALD1 AGBL3 none TRPV6 none none MCAT TSPO TTLL12 SCUBE1 bta-let-7a-3 bta-mir-2443 bta-mir-3596 WNT7B CDPF1 ATXN10 PPARA TRMU GRAMD4 CERK GTSE1 CELSR1 TBC1D22A MAPK12 SELO HDAC10 MAPK11 PLXNB2 DENND6B TUBGCP6 PPP6R2 TECRL C7H5orf45 SQSTM1 TBC1D9B none MGC166429 LSM7 C19orf35 OAZ1 SPPL2B LINGO3 DOT1L OR2AK2 none none none none none none OR2AJ1 none none

ENSBTAG00000016223 ENSBTAG00000046430 ENSBTAG00000013953 ENSBTAG00000013976 ENSBTAG00000015510 ENSBTAG00000024219 ENSBTAG00000047873 ENSBTAG00000045871 ENSBTAG00000002413 ENSBTAG00000018073 ENSBTAG00000001708 ENSBTAG00000011275 ENSBTAG00000029772 ENSBTAG00000045309 ENSBTAG00000036417 ENSBTAG00000009532 ENSBTAG00000008065 ENSBTAG00000009351 ENSBTAG00000008063 ENSBTAG00000005595 ENSBTAG00000021803 ENSBTAG00000046654 ENSBTAG00000007102 ENSBTAG00000008036 ENSBTAG00000012291 ENSBTAG00000019574 ENSBTAG00000000647 ENSBTAG00000011000 ENSBTAG00000030182 ENSBTAG00000014966 ENSBTAG00000024756 ENSBTAG00000000650 ENSBTAG00000018660 ENSBTAG00000024826 ENSBTAG00000015602 ENSBTAG00000015591 ENSBTAG00000015611 ENSBTAG00000001604 ENSBTAG00000040028 ENSBTAG00000004521 ENSBTAG00000016477 ENSBTAG00000018522 ENSBTAG00000004524 ENSBTAG00000016478 ENSBTAG00000009996 ENSBTAG00000007557 ENSBTAG00000047016 ENSBTAG00000046417 ENSBTAG00000027241 ENSBTAG00000045733 ENSBTAG00000046474 ENSBTAG00000046042 ENSBTAG00000040033 ENSBTAG00000030725 ENSBTAG00000047180

47!

!

chr8

94115663

94386951

94115663

94973599

94115663

94386951

loss

chr11 chr11 chr11

46307696 87124625 93546324

47430509 89371911 93612322

46657176 88028793 93445185

46701073 88377200 93587894

46657176 88028793 93546324

46701073 88377200 93587894

gain/loss gain/loss gain/loss

chr11 chr11

99774304 105593624

104856815 106825407

101750113 105699664

101802657 105778702

101750113 105699664

101802657 105778702

gain/loss gain/loss

chr12 chr12

13140896 30099199

13273888 31555734

13179696 30418611

13204137 30646042

13179696 30418611

13204137 30646042

gain/loss gain

chr12 chr13 chr14

57931622 79866776 1435005

58461348 82559505 3664511

57931622 80026050 2721633

58461348 80144645 2803998

57931622 80026050 2721633

58461348 80144645 2803998

loss gain/loss gain/loss

chr 14 chr 14

3885798 6850767

6371334 8264685

3765019 8064004

4017201 8113083

3885798 8064004

4017201 8113083

gain/loss gain/loss

chr 14

8385937

10549180

9300228

9345140

9300228

9345140

gain/loss

chr 14 chr 14 chr16

53415847 79178022 3987821

54164119 79486476 4610955

54023420 79178022 4158997

54123146 79322701 4233985

54023420 79178022 4158997

54123146 79322701 4233985

loss gain/loss gain/loss

chr16

29441057

29661958

29441057

29636822

29441057

29636822

gain/loss

chr16

49355913

49491331

49355913

49455109

49355913

49455109

loss

chr16

69911268

71125864

70906202

71125864

70906202

71125864

gain/loss

chr17 chr17

32731007 55713369

32964041 55941040

32762909 55713369

32964041 55764236

32762909 55713369

32964041 55764236

gain/loss loss

18 chr18 chr18

35971459 42638878 51321651

36040190 42826428 52024379

35971459 42659289 51571629

36107915 42826428 51592949

35971459 42659289 51571629

36040190 42826428 51592949

gain/loss gain/loss gain/loss

chr18

53132012

53224638

53132012

53195763

53132012

53195763

loss

chr18

61095214

61597742

61438125

61920892

61095214

61156737

gain/loss

chr18

63029071

64901743

63119361

63167945

63119361

63167945

gain/loss

chr19

11049355

12032389

11863651

11970132

11863651

11970132

gain/loss

chr19

34371541

36710214

35585081 34836416

35619269 34905583

35585081 34836416

35619269 34905583

gain/loss gain/loss

chr19 chr19

42393606 46396064

43170256 46770465

42352691 46655940

42423488 46723662

42393606 42976859

42423488 43170256

gain/loss gain/loss

chr19 chr19

46396064 50087148

46770465 50567992

46655940 50336021 52175916

46723662 50395622 52264019

46655940 50336021 52175916

46723662 50395622 52264019

gain/loss gain/loss gain/loss

chr19

51148913

52911677

51767413

51842198

chr19

53038373

59742080

56754737 54306610

56837932 54446207

56754737 54306610

56837932 54446207

gain/loss gain/loss

55379112 56072306

55527962 56202223

55379112 56072306

55527962 56202223

gain/loss gain/loss

chr20 chr20

1627053 2880532

2585844 5096097

1741145 2880532

1792368 3189118

1741145 2880532

1792368 3189118

gain/loss gain

chr20

6360647

6416157

6360647

6385223

6360647

6385223

loss

94230962 94205191 46699166 88012967 93563425 93584334 101728372 105698114 105702496 105728961 13183734 30587084 30519852 58187519 80015601 2755206 2770551 2715416 2801383 3870893 8080292 8084721 9334778 9262251 53901591 79296713 4221210 4144349 29552152 29624572 29585792 29238992 49429155 49447984 71019535 71077717 70925149 70932238 71062132 70902206 32712712 55707870 55727012 55759606 36008030 42749252 51520760 51587793 53154421 53129172 53160659 53169569 61145844 61091348 63119873 63146729 11865527 11943185 35557245 34832961 34878438 34817325 42413413 43033597 43148013 43056660 42960226 46650344 50388667 52189629 52181458 52198617 51768184 51781191 51833821 51771254 56754112 54343819 54404340 54312243 55419632 56072684 56171932 56112050 56190846 1452376 2985749 3004314 3064510 3111198 2680574 3132655 6360600

94231065 94210057 46706152 88104077 93564411 93585269 101793685 105702610 105711512 105770612 13266310 30587189 30558210 58187639 80114072 2762197 2775678 2742638 2803020 4065010 8080361 8084808 9371281 9508938 54429251 79298474 4242621 4218744 29561665 29655286 29624037 29442791 49429874 49564506 71024141 71077907 70928253 71016271 71137463 70917245 32889849 55719927 55747669 55773011 36029234 42750804 51578983 51603479 53158137 53153714 53167519 53207223 61145922 61143063 63124888 63154412 11891936 11951411 35646258 34860869 34899068 34872403 42418215 43054075 43162165 43132624 42996671 46775847 50536976 52189720 52196943 52263294 51769908 51829647 51842965 51775213 56818424 54343903 54441590 54405245 55419819 56078553 56175103 56167541 56208380 1893741 2986486 3005537 3066676 3123860 3054892 3195021 6365489

ENSBTAG00000042843 ENSBTAG00000015608 ENSBTAG00000019665 ENSBTAG00000002329 ENSBTAG00000038726 ENSBTAG00000037542 ENSBTAG00000020791 ENSBTAG00000030246 ENSBTAG00000012121 ENSBTAG00000023788 ENSBTAG00000034785 ENSBTAG00000045239 ENSBTAG00000009340 ENSBTAG00000045992 ENSBTAG00000018270 ENSBTAG00000000158 ENSBTAG00000037824 ENSBTAG00000004595 ENSBTAG00000034498 ENSBTAG00000009578 ENSBTAG00000029987 ENSBTAG00000029972 ENSBTAG00000007828 ENSBTAG00000007823 ENSBTAG00000038281 ENSBTAG00000002851 ENSBTAG00000010432 ENSBTAG00000010427 ENSBTAG00000033322 ENSBTAG00000002854 ENSBTAG00000000140 ENSBTAG00000016185 ENSBTAG00000046062 ENSBTAG00000021919 ENSBTAG00000004790 ENSBTAG00000033994 ENSBTAG00000047073 ENSBTAG00000004789 ENSBTAG00000011772 ENSBTAG00000003016 ENSBTAG00000003345 ENSBTAG00000004175 ENSBTAG00000004172 ENSBTAG00000032534 ENSBTAG00000007488 ENSBTAG00000003856 ENSBTAG00000011723 ENSBTAG00000018635 ENSBTAG00000013702 ENSBTAG00000013697 ENSBTAG00000010668 ENSBTAG00000018834 ENSBTAG00000036392 ENSBTAG00000038149 ENSBTAG00000045989 ENSBTAG00000019547 ENSBTAG00000009968 ENSBTAG00000014278 ENSBTAG00000010534 ENSBTAG00000003705 ENSBTAG00000014858 ENSBTAG00000003700 ENSBTAG00000047165 ENSBTAG00000009496 ENSBTAG00000039684 ENSBTAG00000021523 ENSBTAG00000010125 ENSBTAG00000012564 ENSBTAG00000015414 ENSBTAG00000029775 ENSBTAG00000019049 ENSBTAG00000019044 ENSBTAG00000000354 ENSBTAG00000019105 ENSBTAG00000019104 ENSBTAG00000040573 ENSBTAG00000004736 ENSBTAG00000047060 ENSBTAG00000000675 ENSBTAG00000000920 ENSBTAG00000044443 ENSBTAG00000013792 ENSBTAG00000007916 ENSBTAG00000016240 ENSBTAG00000007910 ENSBTAG00000014612 ENSBTAG00000034824 ENSBTAG00000022684 ENSBTAG00000010003 ENSBTAG00000015316 ENSBTAG00000024801 ENSBTAG00000000128 ENSBTAG00000013873

U6 CYLC2 IL1RN ASAP2 none none RAPGEF1 ENTPD8 NOXA1 EXD3 DNAJC15 SNORA70 KATNAL1 none NFATC2 LY6K none GML LY6D PTK2 bta-mir-30d bta-mir-30b SLA TG CSMD3 none EIF2D RASSF5 SRP9 TMEM63A EPHX1 ENAH none NAV1 UBE2T U2 none LGR6 PPP1R12B PTPN7 FAT4 HPD SETD1B RHOF ZFP90 none GRIK5 ATP1A3 ZNF296 CLASRP GEMIN7 PPP1R37 bta-mir-371 NLRP12 CDC42EP5 none TBX4 TBX2 M-RIP FAM83G PRPSAP2 SLC5A10 KRT9 STAT5A PTRF STAT3 STAT5B KANSL1 TBCD bta-mir-338 AATK BAIAP2 PDE6G NPLOC4 C17orf70 TSPAN10 GRB2 none PGS1 DNAH17 SCARNA16 UBALD2 FOXJ1 RNF157 EXOC7 DOCK2 none none TLX3 NPM1 RANBP17 FGF18 MSX2

48!

!

chr21

70089833

71136925

70089833

71210609

70089833

71136925

gain/loss

chr22

16219978

16342830

16219978

16407075

16219978

16342830

gain

chr22 chr22 chr22

19409002 39545402 54440045

19588936 39702951 61040701

19409002 39545402 60435042

19588936 39657636 60508872

19409002 39545402 60435042

19588936 39657636 60508872

gain/loss loss gain/loss

59951940

60243916

59951940

60243916

gain/loss

chr24 chr24 chr25

541784 39320770 472458

1094942 39365195 5156189

1027534 39320770 609241

1137518 39365195 983759

1027534 39320770 609241

1094942 39365195 983759

gain/loss gain/loss gain/loss

chr25 chr25

36980815 38856905

38698430 39921068

37988321 39286957 39785037

38142895 39424763 39844749

37988321 39544407 39785037

38142895 39570754 39844749

gain gain/loss gain/loss

39286957

39424763

39286957

39424763

gain/loss

5288263 5504271 25982293

loss loss gain/loss

chr26

5258082

5526925

5472360

5504271

chr26

25501890

26124236

25828973

25982293

5258082 5472360 25828973

chr27

4357162

5000552

4544917

4773381

4544917

4773381

gain

6334557 26994978 35136093 48178151

6547497 27072121 35169599 48252404

gain/loss gain/loss gain gain/loss

chr28

6334557

6547497

6334557

6547497

chr29 chr29

35051920 45817015

36669359 50999092

35136093 48178151

35169599 48252404

70113045 70114200 70133009 70717761 70870027 70903809 70999273 71011580 71041900 71052184 71077800 70123917 70269910 70313782 70707408 70827525 70845971 70878138 70919570 16310518 16247929 18740484 39175038 60443564 60502719 60507746 60016985 60039910 59952594 60179708 60217808 60063340 1018253 39312037 613234 618418 624818 627456 649253 665058 676665 787493 857167 865752 871131 620322 668529 724446 959758 653105 38041960 39565711 39840013 39761774 39292721 39308651 39343633 39359290 5017714 5017714 25856475 25872737 25881752 25928928 25938181 25828813 25893499 25960809 25944197 4677302 4766514 4313369 4679600 6492389 26985668 35154689 48167168 48217044

70118400 70114755 70134255 70727303 70874415 70905041 71004734 71016820 71047128 71052852 71078924 70233306 70292666 70351845 70715785 70839732 70861972 70895537 70983506 16348300 16308333 19647747 40360572 60493810 60507367 60556978 60024586 60040605 59965985 60211026 60229341 60172924 1099817 39404644 615345 619923 627214 633977 652835 668257 677047 790981 858273 867111 877122 623768 676616 775899 984950 660655 38053172 39589412 39840088 39816244 39302192 39309366 39347044 39376730 5578654 5578654 25865594 25875735 25885322 25930145 25941636 25855778 25904421 25972557 25958640 4677407 4783646 4554747 4727246 6559855 27080093 35575203 48194210 48378574

ENSBTAG00000026886 ENSBTAG00000046186 ENSBTAG00000046401 ENSBTAG00000006673 ENSBTAG00000017622 ENSBTAG00000005038 ENSBTAG00000015160 ENSBTAG00000046828 ENSBTAG00000010370 ENSBTAG00000031242 ENSBTAG00000005647 ENSBTAG00000020402 ENSBTAG00000017194 ENSBTAG00000021904 ENSBTAG00000022775 ENSBTAG00000007187 ENSBTAG00000017616 ENSBTAG00000017636 ENSBTAG00000004802 ENSBTAG00000016622 ENSBTAG00000044167 ENSBTAG00000013047 ENSBTAG00000021911 ENSBTAG00000018248 ENSBTAG00000018238 ENSBTAG00000018031 ENSBTAG00000019707 ENSBTAG00000006179 ENSBTAG00000005191 ENSBTAG00000020998 ENSBTAG00000004937 ENSBTAG00000030962 ENSBTAG00000000656 ENSBTAG00000019251 ENSBTAG00000020198 ENSBTAG00000002467 ENSBTAG00000002481 ENSBTAG00000002484 ENSBTAG00000000177 ENSBTAG00000000179 ENSBTAG00000033526 ENSBTAG00000020737 ENSBTAG00000039974 ENSBTAG00000033481 ENSBTAG00000012601 ENSBTAG00000002470 ENSBTAG00000019743 ENSBTAG00000019745 ENSBTAG00000026461 ENSBTAG00000033580 ENSBTAG00000045896 ENSBTAG00000012049 ENSBTAG00000047050 ENSBTAG00000019310 ENSBTAG00000003191 ENSBTAG00000047781 ENSBTAG00000026199 ENSBTAG00000010264 ENSBTAG00000045905 ENSBTAG00000045905 ENSBTAG00000017710 ENSBTAG00000005715 ENSBTAG00000013717 ENSBTAG00000046499 ENSBTAG00000012416 ENSBTAG00000018321 ENSBTAG00000000791 ENSBTAG00000023832 ENSBTAG00000006395 ENSBTAG00000043496 ENSBTAG00000007473 ENSBTAG00000011032 ENSBTAG00000004922 ENSBTAG00000004515 ENSBTAG00000021177 ENSBTAG00000010032 ENSBTAG00000006071 ENSBTAG00000003171

MP68 none RD3L TMEM179 SIVA1 ZBTB42 PLD4 none C14orf79 CDCA4 GPR132 TDRD9 ASPG KIF26A C14orf180 INF2 ADSSL1 AKT1 CEP170B TCAIM TOPAZ1 GRM7 PTPRG MGLL ABTB1 PODXL2 GATA2 DNAJB8 RPN1 RUVBL1 SEC61A1 EEFSEC NFATC1 EPB41L3 METRN FAM173A HAGHL NARFL MSLN RPUSD1 GNG13 SOX8 SSTR5 C1QTNF8 TEKT4 CCDC78 CHTF18 LMF1 CACNA1H MSLNL NPTX2 WIPI2 bta-mir-2890 FOXK1 FSCN1 none ACTB FBXL18 PCDH15 PCDH15 ECHS1 FUOM PRAP1 none ZNF511 PAOX CALY ADAM8 TUBGCP2 U6 XKR5 MCPH1 AGPAT5 KCNK1 ADAMTS14 NTM CTTN SHANK2

49!

Supplementary File 4: GO and pathways analyses performed using DAVID on line database with high classification stringency option and the FDR correction (sheet 1: gene clustered_DAVID; sheet 2: genes not clustered_DAVID). Clustered_DAVID Category Annotation Cluster 1 GOTERM_BP_FAT

KEGG_PATHWAY

Annotation Cluster 2 GOTERM_BP_FAT

Annotation Cluster 3 GOTERM_BP_FAT

!

ID Enrichment Score: 2.73 GO:0043434

Term

P-Value

response to peptide 1.22E+12 hormone stimulus GO:0032870 cellular response to 1.40E+12 hormone stimulus GO:0009719 response to endogenous 2.67E+11 stimulus GO:0009725 response to hormone 1.46E-03 stimulus bta05221 Acute myeloid leukemia 3.29E-03 bta05220 Chronic myeloid 5.08E-02 leukemia bta04630 Jak-STAT signaling 6.72E-02 pathway AKT1, GRB2, STAT5A, STAT5B, NR4A2, STAT3 Enrichment Score: 2.68 GO:0060397 JAK-STAT cascade 2.57E+12 involved in growth hormone signaling pathway GO:0060396 growth hormone 8.45E+11 receptor signaling pathway GO:0060416 response to growth 8.45E+11 hormone stimulus GO:0007259 JAK-STAT cascade 3.69E-03 GO:0040014 regulation of 5.23E-03 multicellular organism growth GO:0019221 cytokine-mediated 2.25E-02 signaling pathway STAT5A, CSF1, STAT5B, STAT3 Enrichment Score: 1.69 GO:0045137 development of primary 6.92E-03 sexual characteristics GO:0003006 reproductive 1.22E-02 developmental process GO:0007548 sex differentiation 1.45E-02 GO:0046661 male sex differentiation 2.08E-02 GO:0008406 gonad development 4.87E-02 GO:0048608 reproductive structure 6.08E-02

FDR 1.9E-1 2.1E-1 4.1E-1 2.2E0 3.5E0 4.3E1 5.3E1

3.9E-1

1.3E0 1.3E0 5.5E0 7.7E0 2.9E1

1.0E1 1.7E1 2.0E1 2.7E1 5.3E1 6.2E1 50!

development FOXJ1, STAT5A, CSF1, STAT5B, DHCR24 Annotation Cluster 4 Enrichment Score: 1.60 GOTERM_BP_FAT GO:0051056 regulation of small 4.08E-03 GTPase mediated signal transduction GO:0030695 GTPase regulator 4.38E-02 activity GO:0005083 small GTPase regulator 4.52E-02 activity GO:0060589 nucleoside4.92E-02 triphosphatase regulator activity CSF1, TBC1D5, ASAP2, MGC166429, RAPGEF1, TBC1D22A, TBC1D9B Annotation Cluster 5 Enrichment Score: 1.45 GOTERM_BP_FAT GO:0002763 positive regulation of 2.32E-03 myeloid leukocyte differentiation GO:0040014 regulation of 5.23E-03 multicellular organism growth GO:0045639 positive regulation of 8.35E-03 myeloid cell differentiation GO:0040018 positive regulation of 8.35E-03 multicellular organism growth GO:0002761 regulation of myeloid 1.33E-02 leukocyte differentiation GO:0045637 regulation of myeloid 3.56E-02 cell differentiation GO:0070665 positive regulation of 4.20E-02 leukocyte proliferation GO:0032946 positive regulation of 4.20E-02 mononuclear cell proliferation GO:0045927 positive regulation of 4.42E-02 growth GO:0045597 positive regulation of 5.02E-02 cell differentiation GO:0032944 regulation of 5.58E-02 mononuclear cell proliferation GO:0070663 regulation of leukocyte 5.58E-02 proliferation GO:0051094 positive regulation of 8.86E-02 developmental process GO:0048872 homeostasis of number 1.02E-01 of cells GO:0030155 regulation of cell 1.17E-01 adhesion !

6.0E0 4.4E1 4.5E1 4.7E1

3.5E0 7.7E0 1.2E1 1.2E1 1.8E1 4.2E1 4.8E1 4.8E1 5.0E1 5.4E1 5.8E1 5.8E1 7.6E1 8.1E1 8.5E1 51!

GO:0008284

positive regulation of 1.71E-01 9.4E1 cell proliferation GO:0051240 positive regulation of 2.53E-01 9.9E1 multicellular organismal process METRN, STAT5A, CSF1, STAT5B, STAT3 Annotation Cluster 6 Enrichment Score: 1.40 GOTERM_BP_FAT GO:0032318 regulation of Ras 1.38E-02 1.9E1 GTPase activity GOTERM_BP_FAT GO:0043087 regulation of GTPase 2.08E-02 2.7E1 activity GOTERM_MF_FAT GO:0008047 enzyme activator 3.23E-02 3.4E1 activity GOTERM_BP_FAT GO:0032313 regulation of Rab 3.56E-02 4.2E1 GTPase activity GOTERM_BP_FAT GO:0032483 regulation of Rab 3.56E-02 4.2E1 protein signal transduction GOTERM_MF_FAT GO:0005097 Rab GTPase activator 3.67E-02 3.8E1 activity GOTERM_MF_FAT GO:0005083 small GTPase regulator 4.52E-02 4.5E1 activity GOTERM_MF_FAT GO:0005096 GTPase activator 5.53E-02 5.2E1 activity GOTERM_MF_FAT GO:0005099 Ras GTPase activator 6.16E-02 5.6E1 activity GOTERM_BP_FAT GO:0051336 regulation of hydrolase 1.42E-01 9.0E1 activity TBC1D5, ASAP2, MGC166429, TBC1D22A, TBC1D9B, NOXA1 Annotation Cluster 7 Enrichment Score: 1.11 GOTERM_BP_FAT GO:0006468 protein amino acid 5.68E-02 5.9E1 phosphorylation GOTERM_BP_FAT GO:0006796 phosphate metabolic 7.71E-02 7.1E1 process GOTERM_BP_FAT GO:0006793 phosphorus metabolic 7.71E-02 7.1E1 process GOTERM_BP_FAT GO:0016310 phosphorylation 1.12E-01 8.4E1 PTPN7, AKT1, EPHA4, PTK2, MAPK12, PTPRG, STAT5A, STAT5B, MAPK11, PDE6G, AATK Annotation Cluster 8 Enrichment Score: 1.03 GOTERM_BP_FAT GO:0008344 adult locomotory 2.25E-02 2.9E1 behavior GOTERM_BP_FAT GO:0030534 adult behavior 6.84E-02 6.6E1 GOTERM_BP_FAT GO:0007610 behavior 2.04E-01 9.7E1 GOTERM_BP_FAT GO:0007626 locomotory behavior 2.39E-01 9.8E1 EPHA4, ATP1A3, NR4A2, STAT3 Annotation Cluster 9 Enrichment Score: 1.03 GOTERM_MF_FAT GO:0017076 purine nucleotide 6.80E-02 5.9E1 binding !

52!

GO:0001883

purine nucleoside 7.18E-02 6.1E1 binding GO:0001882 nucleoside binding 7.46E-02 6.3E1 GO:0032555 purine ribonucleotide 8.30E-02 6.7E1 binding GO:0032553 ribonucleotide binding 8.30E-02 6.7E1 GO:0000166 nucleotide binding 9.38E-02 7.2E1 GO:0030554 adenyl nucleotide 1.17E-01 8.0E1 binding GO:0005524 ATP binding 1.38E-01 8.5E1 GO:0032559 adenyl ribonucleotide 1.45E-01 8.6E1 binding ACTB, PGS1, ADSSL1, SETD1B, TDRD9, ATP1A3, MAPK11, PDE6G, TPK1, AKT1, EPHA4, NAV1, MAPK12, PARS2, ENTPD8, RUVBL1, EEFSEC, RHOF, UBE2T, DHCR24, AATK Annotation Cluster 10 Enrichment Score: 0.97 GOTERM_BP_FAT GO:0032989 cellular component 2.99E-02 3.7E1 morphogenesis GO:0000904 cell morphogenesis 3.39E-02 4.1E1 involved in differentiation GO:0000902 cell morphogenesis 7.64E-02 7.0E1 GO:0007409 axonogenesis 9.60E-02 7.9E1 GO:0030182 neuron differentiation 1.03E-01 8.1E1 GO:0048812 neuron projection 1.05E-01 8.1E1 morphogenesis GO:0048667 cell morphogenesis 1.17E-01 8.5E1 involved in neuron differentiation GO:0048858 cell projection 1.23E-01 8.6E1 morphogenesis GO:0032990 cell part morphogenesis 1.42E-01 9.0E1 GO:0031175 neuron projection 1.48E-01 9.1E1 development GO:0048666 neuron development 2.39E-01 9.8E1 GO:0006928 cell motion 4.03E-01 1.0E2 ACTB, EPHA4, PTK2, NR4A2, NFATC1, STAT3 Annotation Cluster 11 Enrichment Score: 0.83 GOTERM_BP_FAT GO:0006417 regulation of translation 8.74E-02 7.5E1 GO:0010608 posttranscriptional 1.85E-01 9.6E1 regulation of gene expression GO:0032268 regulation of cellular 2.00E-01 9.7E1 protein metabolic process AKT1, CSF1, EEFSEC, SRP9 Annotation Cluster 12 Enrichment Score: 0.81 GOTERM_CC_FAT GO:0005856 cytoskeleton 3.83E-02 3.5E1 GO:0043228 non-membrane-bounded 3.12E-01 9.8E1 organelle !

53!

GO:0043232

intracellular non3.12E-01 9.8E1 membrane-bounded organelle AKT1, ACTB, FGF18, CYLC2, PTK2, TUBGCP6, EXOC7, CALD1, NPM1, TEKT4, TUBGCP2, RHOF Annotation Cluster 13 Enrichment Score: 0.76 GOTERM_BP_FAT GO:0009165 nucleotide biosynthetic 1.65E-01 9.4E1 process GOTERM_BP_FAT GO:0034654 nucleobase, nucleoside, 1.81E-01 9.5E1 nucleotide and nucleic acid biosynthetic process GOTERM_BP_FAT GO:0034404 nucleobase, nucleoside 1.81E-01 9.5E1 and nucleotide biosynthetic process ADSSL1, ENTPD8, ATP1A3, PRPSAP2 Annotation Cluster 14 Enrichment Score: 0.70 KEGG_PATHWAY bta04664 Fc epsilon RI signaling 4.92E-02 4.2E1 pathway KEGG_PATHWAY bta04914 Progesterone-mediated 2.34E-01 9.5E1 oocyte maturation KEGG_PATHWAY bta04620 Toll-like receptor 2.89E-01 9.8E1 signaling pathway GOTERM_MF_FAT GO:0004674 protein serine/threonine 4.78E-01 1.0E2 kinase activity AKT1, MAPK12, MAPK11, AATK, GRB2 Annotation Cluster 15 Enrichment Score: 0.66 GOTERM_BP_FAT GO:0043066 negative regulation of 1.56E-01 9.2E1 apoptosis GO:0043069 negative regulation of 1.60E-01 9.3E1 programmed cell death GO:0060548 negative regulation of 1.60E-01 9.3E1 cell death GO:0042981 regulation of apoptosis 2.96E-01 1.0E2 GO:0043067 regulation of 3.03E-01 1.0E2 programmed cell death GO:0010941 regulation of cell death 3.05E-01 1.0E2 MSX2, SIVA1, STAT5A, STAT5B, NR4A2 Annotation Cluster 16 Enrichment Score: 0.62 GOTERM_BP_FAT GO:0019216 regulation of lipid 4.87E-02 5.3E1 metabolic process GO:0010628 positive regulation of 1.41E-01 9.0E1 gene expression GO:0045944 positive regulation of 1.58E-01 9.3E1 transcription from RNA polymerase II promoter GO:0051254 positive regulation of 2.17E-01 9.8E1 RNA metabolic process GO:0045893 positive regulation of 2.17E-01 9.8E1 !

54!

transcription, DNAdependent GO:0045941 positive regulation of 2.99E-01 1.0E2 transcription GO:0045935 positive regulation of 3.61E-01 1.0E2 nucleobase, nucleoside, nucleotide and nucleic acid metabolic process GO:0051173 positive regulation of 3.79E-01 1.0E2 nitrogen compound metabolic process GO:0010557 positive regulation of 4.04E-01 1.0E2 macromolecule biosynthetic process GO:0031328 positive regulation of 4.32E-01 1.0E2 cellular biosynthetic process GO:0009891 positive regulation of 4.39E-01 1.0E2 biosynthetic process PPARA, STAT5A, CSF1, STAT5B, NR4A2 Annotation Cluster 17 Enrichment Score: 0.49 GOTERM_MF_FAT GO:0003700 transcription factor 1.24E-01 8.2E1 activity GO:0030528 transcription regulator 3.35E-01 9.9E1 activity GOTERM_BP_FAT GO:0006355 regulation of 3.91E-01 1.0E2 transcription, DNAdependent GO:0051252 regulation of RNA 4.11E-01 1.0E2 metabolic process GO:0045449 regulation of 5.34E-01 1.0E2 transcription MSX2, PPARA, TRMU, ZFP90, STAT5A, TBX4, STAT5B, NARFL, HDAC10, NR4A2, STAT3, NFATC1 Annotation Cluster 18 Enrichment Score: 0.30 GOTERM_CC_FAT GO:0031981 nuclear lumen 4.50E-01 1.0E2 GOTERM_CC_FAT GO:0070013 intracellular organelle 5.03E-01 1.0E2 lumen GOTERM_CC_FAT GO:0043233 organelle lumen 5.04E-01 1.0E2 GOTERM_CC_FAT GO:0031974 membrane-enclosed 5.41E-01 1.0E2 lumen ACTB, FGF18, NPM1, HDAC10, ECHS1, GEMIN7 Annotation Cluster 19 Enrichment Score: 0.25 GOTERM_BP_FAT GO:0010558 negative regulation of 5.21E-01 1.0E2 macromolecule biosynthetic process GO:0031327 negative regulation of 5.30E-01 1.0E2 cellular biosynthetic process GO:0009890 negative regulation of 5.47E-01 1.0E2 biosynthetic process !

55!

GO:0010605

negative regulation of 6.40E-01 1.0E2 macromolecule metabolic process PPARA, HDAC10, SRP9 Annotation Cluster 20 Enrichment Score: 0.25 GOTERM_MF_FAT GO:0046872 metal ion binding 5.35E-01 1.0E2! GO:0043169 cation binding 5.61E-01 1.0E2! GO:0043167 ion binding 5.82E-01 1.0E2! PPARA, NPLOC4, ADSSL1, TRMU, STAT5A, ZNF296, SCUBE1, STAT5B, ASAP2, NR4A2, CELSR1, KCNK1, STAT3, PRPSAP2, POMGNT1, SQSTM1, ZFP90, ENTPD8, HAGHL, ADAM8, SLC5A10, TBC1D9B, HPD Annotation Cluster 21 Enrichment Score: 0.24 GOTERM_MF_FAT GO:0032561 guanyl ribonucleotide 5.08E-01 1.0E2! binding GOTERM_MF_FAT GO:0019001 guanyl nucleotide 5.15E-01 1.0E2! binding GOTERM_MF_FAT GO:0005525 GTP binding 7.44E-01 1.0E2! ADSSL1, EEFSEC, PDE6G, RHOF Annotation Cluster 22 Enrichment Score: 0.19 GOTERM_BP_FAT GO:0006886 intracellular protein 5.61E-01 1.0E2 transport GO:0034613 cellular protein 5.98E-01 1.0E2 localization GO:0070727 cellular macromolecule 6.00E-01 1.0E2 localization GO:0008104 protein localization 6.04E-01 1.0E2 GO:0015031 protein transport 7.33E-01 1.0E2 GO:0045184 establishment of protein 7.35E-01 1.0E2 localization GO:0046907 intracellular transport 7.43E-01 1.0E2 RANBP17, LMF1, SEC61A1, SRP9, DHCR24 Annotation Cluster 23 Enrichment Score: 0.14 GOTERM_MF_FAT GO:0005216 ion channel activity 7.11E-01 1.0E2 GO:0022838 substrate specific 7.17E-01 1.0E2 channel activity GO:0015267 channel activity 7.24E-01 1.0E2 GO:0022803 passive transmembrane 7.24E-01 1.0E2 transporter activity GRIK5, CACNA1H, KCNK1

!

56!

Category GOTERM_ BP_FAT

Term GO:0009719 GO:0010033 GO:0051056 GO:0040014 GO:0046578 GO:0045137 GO:0007167 GO:0007169 GO:0003006 GO:0007243 GO:0007548 GO:0000226 GO:0007010 GO:0046661 GO:0030030 GO:0032989 GO:0000904

!

Genes response to endogenous stimulus AKT1, GRB2, STAT5A, STAT5B, NR4A2, STAT3 response to organic substance MSX2, AKT1, GRB2, STAT5A, STAT5B, NR4A2, EPHX1, STAT3 regulation of small GTPase CSF1, TBC1D5, ASAP2, MGC166429, mediated signal transduction RAPGEF1, TBC1D22A, TBC1D9B regulation of multicellular STAT5A, CSF1, STAT5B, STAT3 organism growth regulation of Ras protein signal CSF1, TBC1D5, ASAP2, MGC166429, transduction TBC1D22A, TBC1D9B development of primary sexual FOXJ1, STAT5A, STAT5B, DHCR24 characteristics enzyme linked receptor protein MSX2, EPHA4, GRB2, STAT5A, STAT5B, signaling pathway STAT3 transmembrane receptor protein EPHA4, GRB2, STAT5A, STAT5B, tyrosine kinase signaling STAT3 pathway reproductive developmental FOXJ1, STAT5A, CSF1, STAT5B, process DHCR24 protein kinase cascade GRB2, STAT5A, STAT5B, PDE6G, STAT3 sex differentiation FOXJ1, STAT5A, STAT5B, DHCR24 microtubule cytoskeleton PTK2, TUBGCP6, TEKT4, TUBGCP2 organization cytoskeleton organization ACTB, PTK2, TUBGCP6, TEKT4, TUBGCP2, RHOF male sex differentiation STAT5A, STAT5B, DHCR24 cell projection organization EPHA4, PTK2, BAIAP2, NR4A2, TEKT4 cellular component ACTB, EPHA4, PTK2, NR4A2, NFATC1 morphogenesis cell morphogenesis involved in EPHA4, PTK2, NR4A2, NFATC1

FDR 2.70E-04

P-Value 2.67E+11

1.90E-03

1.92E-03

4.10E-03

4.08E-03

5.20E-03

5.23E-03

6.30E-03

6.34E-03

6.90E-03

6.92E-03

9.20E-03

9.23E-03

1.10E-02

1.06E-02

1.20E-02

1.22E-02

1.40E-02

1.40E-02

1.50E-02 1.80E-02

1.45E-02 1.83E-02

2.00E-02

1.97E-02

2.10E-02 2.20E-02 3.00E-02

2.08E-02 2.17E-02 2.99E-02

3.40E-02

3.39E-02 57!

GO:0000902 GO:0008544 GO:0006793

differentiation negative regulation of cell differentiation regulation of growth cellular amino acid derivative metabolic process gonad development regulation of lipid metabolic process positive regulation of cell differentiation protein amino acid phosphorylation reproductive structure development nitrogen compound biosynthetic process cell morphogenesis epidermis development phosphorus metabolic process

GO:0006796

phosphate metabolic process

GO:0006357

regulation of transcription from RNA polymerase II promoter ectoderm development sulfur metabolic process regulation of translation positive regulation of developmental process fatty acid metabolic process neuron differentiation

GO:0045596 GO:0040008 GO:0006575 GO:0008406 GO:0019216 GO:0045597 GO:0006468 GO:0048608 GO:0044271

GO:0007398 GO:0006790 GO:0006417 GO:0051094 GO:0006631 GO:0030182 !

PPARA, PTK2, STAT5A, STAT5B

3.50E-02

3.50E-02

PTK2, STAT5A, CSF1, STAT5B, STAT3 PAOX, STAT5A, STAT5B, NR4A2

3.70E-02 4.40E-02

3.72E-02 4.35E-02

FOXJ1, STAT5A, STAT5B PPARA, STAT5A, STAT5B

4.90E-02 4.90E-02

4.87E-02 4.87E-02

METRN, STAT5A, CSF1, STAT5B

5.00E-02

5.02E-02

AKT1, EPHA4, PTK2, MAPK12, STAT5A, STAT5B, MAPK11, PDE6G, AATK FOXJ1, STAT5A, STAT5B

5.70E-02

5.68E-02

6.10E-02

6.08E-02

TPK1, ADSSL1, ENTPD8, ATP1A3, NR4A2, PRPSAP2 EPHA4, PTK2, NR4A2, NFATC1 AKT1, PPARA, DHCR24 PTPN7, AKT1, EPHA4, PTK2, MAPK12, PTPRG, STAT5A, STAT5B, MAPK11, PDE6G, AATK PTPN7, AKT1, EPHA4, PTK2, MAPK12, PTPRG, STAT5A, STAT5B, MAPK11, PDE6G, AATK PPARA, STAT5A, STAT5B, HDAC10, NR4A2, STAT3 AKT1, PPARA, DHCR24 TPK1, STAT5A, STAT5B AKT1, EEFSEC, SRP9 METRN, STAT5A, CSF1, STAT5B

7.60E-02

7.64E-02

7.60E-02 7.60E-02 7.70E-02

7.64E-02 7.64E-02 7.71E-02

7.70E-02

7.71E-02

8.10E-02

8.06E-02

8.50E-02 8.50E-02 8.70E-02 8.90E-02

8.46E-02 8.46E-02 8.74E-02 8.86E-02

PPARA, STAT5A, STAT5B, ECHS1 EPHA4, PTK2, NR4A2, STAT3

9.00E-02 1.00E-01

9.04E-02 1.03E-01 58!

GO:0016310

phosphorylation

GO:0007017 GO:0010628

microtubule-based process positive regulation of gene expression positive regulation of macromolecule metabolic process positive regulation of cell proliferation posttranscriptional regulation of gene expression regulation of cellular protein metabolic process behavior secretion by cell glycoprotein metabolic process regulation of cell proliferation secretion positive regulation of signal transduction positive regulation of cell communication regulation of transcription, DNA-dependent

GO:0010604 GO:0008284 GO:0010608 GO:0032268 GO:0007610 GO:0032940 GO:0009100 GO:0042127 GO:0046903 GO:0009967 GO:0010647 GO:0006355 GO:0048609 GO:0032504 GO:0043085 GO:0051252 !

reproductive process in a multicellular organism multicellular organism reproduction positive regulation of catalytic activity regulation of RNA metabolic process

AKT1, EPHA4, PTK2, MAPK12, STAT5A, STAT5B, MAPK11, PDE6G, AATK PTK2, TUBGCP6, TEKT4, TUBGCP2 PPARA, STAT5A, CSF1, STAT5B, NR4A2 AKT1, PPARA, STAT5A, CSF1, STAT5B, NR4A2

1.10E-01

1.12E-01

1.30E-01 1.40E-01

1.28E-01 1.41E-01

1.60E-01

1.56E-01

FGF18, STAT5A, CSF1, STAT5B

1.70E-01

1.71E-01

AKT1, EEFSEC, SRP9

1.80E-01

1.85E-01

AKT1, CSF1, EEFSEC, SRP9

2.00E-01

2.00E-01

EPHA4, ATP1A3, NR4A2, STAT3 EXOC7, LMF1, SCRN1 POMGNT1, RPN1, DHCR24 MSX2, FGF18, STAT5A, CSF1, STAT5B EXOC7, LMF1, SCRN1 FGF18, CSF1, PDE6G

2.00E-01 2.20E-01 2.30E-01 2.50E-01 3.10E-01 3.20E-01

2.04E-01 2.19E-01 2.29E-01 2.55E-01 3.05E-01 3.19E-01

FGF18, CSF1, PDE6G

3.40E-01

3.40E-01

MSX2, PPARA, ZFP90, STAT5A, TBX4, STAT5B, HDAC10, NR4A2, STAT3, NFATC1 CYLC2, STAT5A, STAT5B

3.90E-01

3.91E-01

4.00E-01

4.00E-01

CYLC2, STAT5A, STAT5B

4.00E-01

4.00E-01

CSF1, NR4A2, PDE6G

4.10E-01

4.07E-01

MSX2, PPARA, ZFP90, STAT5A, TBX4, STAT5B, HDAC10, NR4A2, STAT3,

4.10E-01

4.11E-01 59!

GO:0042592 GO:0044093 GO:0006350

homeostatic process positive regulation of molecular function transcription

GO:0007242

intracellular signaling cascade

GO:0006811

ion transport

GO:0045449

regulation of transcription

GO:0015672

monovalent inorganic cation transport protein localization

GO:0008104 GO:0006812 GO:0016192 GO:0050877 GO:0007166

cation transport vesicle-mediated transport neurological system process cell surface receptor linked signal transduction

GO:0015031 GO:0045184

protein transport establishment of protein localization metal ion transport macromolecule catabolic process transmembrane transport proteolysis G-protein coupled receptor protein signaling pathway cell leading edge

GO:0030001 GO:0009057 GO:0055085 GO:0006508 GO:0007186 GOTERM_ CC_FAT !

GO:0031252

NFATC1 STAT5A, CSF1, STAT5B, NARFL, STAT3 CSF1, NR4A2, PDE6G

4.20E-01 4.90E-01

4.20E-01 4.86E-01

PPARA, STAT5A, STAT5B, NR4A2, STAT3, NFATC1 GRB2, STAT5A, STAT5B, PDE6G, RHOF, STAT3 ATP1A3, GRIK5, CACNA1H, KCNK1, SLC5A10, NFATC1 MSX2, PPARA, TRMU, ZFP90, STAT5A, TBX4, STAT5B, NARFL, HDAC10, NR4A2, STAT3, NFATC1 ATP1A3, KCNK1, SLC5A10

4.90E-01

4.89E-01

5.00E-01

5.00E-01

5.20E-01

5.23E-01

5.30E-01

5.34E-01

5.80E-01

5.82E-01

RANBP17, LMF1, SEC61A1, SRP9, DHCR24 ATP1A3, KCNK1, SLC5A10, NFATC1 CALY, EXOC7, SCRN1 PTK2, ATP1A3, PDE6G CALY, GRB2, STAT5A, STAT5B, ATP1A3, GPR132, CELSR1, STAT3, MSX2, EPHA4, SSTR5, WNT7B, GRM7 RANBP17, LMF1, SEC61A1, SRP9 RANBP17, LMF1, SEC61A1, SRP9

6.00E-01

6.04E-01

6.50E-01 6.90E-01 7.00E-01 7.20E-01

6.54E-01 6.91E-01 6.99E-01 7.21E-01

7.30E-01 7.30E-01

7.33E-01 7.35E-01

KCNK1, SLC5A10, NFATC1 AKT1, UBE2T, DHCR24 CACNA1H, SLC5A10, SEC61A1 ADAM8, UBE2T, DHCR24 SSTR5, CALY, GRM7, GPR132, CELSR1

7.50E-01 8.20E-01 8.80E-01 9.80E-01 1.00E+00

7.51E-01 8.15E-01 8.84E-01 9.82E-01 9.97E-01

AKT1, CTTN, PTK2, BAIAP2

6.60E-03

6.59E-03 60!

!

GO:0005938 GO:0030027 GO:0042995

cell cortex lamellipodium cell projection

GO:0005856

cytoskeleton

GO:0044448 GO:0005819 GO:0015630

cell cortex part spindle microtubule cytoskeleton

GO:0044430

cytoskeletal part

GO:0005815 GO:0048471 GO:0043228

microtubule organizing center perinuclear region of cytoplasm non-membrane-bounded organelle

GO:0043232

intracellular non-membranebounded organelle

GO:0005654 GO:0031981 GO:0012505 GO:0005886

nucleoplasm nuclear lumen endomembrane system plasma membrane

GO:0044451 GO:0000267 GO:0005783 GO:0005739

nucleoplasm part cell fraction endoplasmic reticulum mitochondrion

GO:0031090

organelle membrane

ACTB, CTTN, EXOC7, CALD1 AKT1, CTTN, PTK2 AKT1, CTTN, PTK2, BAIAP2, FSCN1, TEKT4 AKT1, ACTB, CYLC2, PTK2, TUBGCP6, EXOC7, CALD1, TEKT4, TUBGCP2, RHOF ACTB, EXOC7, CALD1 AKT1, TUBGCP6, TUBGCP2 AKT1, TUBGCP6, EXOC7, TEKT4, TUBGCP2 AKT1, CYLC2, TUBGCP6, EXOC7, CALD1, TEKT4, TUBGCP2 TUBGCP6, EXOC7, TUBGCP2 CYLC2, ATXN10, CSF1 AKT1, ACTB, FGF18, CYLC2, PTK2, TUBGCP6, EXOC7, CALD1, NPM1, TEKT4, TUBGCP2, RHOF AKT1, ACTB, FGF18, CYLC2, PTK2, TUBGCP6, EXOC7, CALD1, NPM1, TEKT4, TUBGCP2, RHOF ACTB, NPM1, HDAC10, GEMIN7 ACTB, FGF18, NPM1, HDAC10, GEMIN7 POMGNT1, GRB2, SCRN1, SEC61A1 AKT1, PTK2, CALY, CALD1, FSCN1, ENTPD8, GRIK5, CELSR1, RHOF, NTM, STAT3 ACTB, HDAC10, GEMIN7 ACTB, CALD1, ENTPD8 PGS1, LMF1, RPN1, SEC61A1 PGS1, TRMU, TSPO, AGPAT5, ECHS1, MP68 POMGNT1, GRB2, SCRN1, SEC61A1

2.10E-02 2.40E-02 3.30E-02

2.13E-02 2.39E-02 3.27E-02

3.80E-02

3.83E-02

5.70E-02 8.80E-02 1.00E-01

5.66E-02 8.84E-02 9.98E-02

1.00E-01

1.03E-01

1.50E-01 2.10E-01 3.10E-01

1.54E-01 2.06E-01 3.12E-01

3.10E-01

3.12E-01

3.70E-01 4.50E-01 4.60E-01 4.90E-01

3.66E-01 4.50E-01 4.62E-01 4.89E-01

5.50E-01 5.70E-01 7.00E-01 7.10E-01

5.49E-01 5.73E-01 6.98E-01 7.14E-01

8.20E-01

8.22E-01 61!

GOTERM_ MF_FAT

!

GO:0005576

extracellular region

GO:0031224

intrinsic to membrane

GO:0016021

integral to membrane

GO:0044459 GO:0008047

plasma membrane part enzyme activator activity

GO:0030695

GTPase regulator activity

GO:0005083

small GTPase regulator activity

GO:0060589 GO:0019904 GO:0017076

nucleoside-triphosphatase regulator activity protein domain specific binding purine nucleotide binding

GO:0001883

purine nucleoside binding

GO:0001882

nucleoside binding

TG, FGF18, WNT7B, METRN, FOXJ1, IL1RN TSPO, CALY, CSF1, LMF1, SPPL2B, GRIK5, ATP1A3, GPR132, KCNK1, EPHA4, SSTR5, POMGNT1, TSPAN10, TECRL, GRM7, ENTPD8, RPN1, CACNA1H, SLC5A10, SEC61A1, NTM, AATK TSPO, CALY, CSF1, LMF1, SPPL2B, ATP1A3, GRIK5, GPR132, KCNK1, EPHA4, SSTR5, POMGNT1, TSPAN10, TECRL, GRM7, ENTPD8, RPN1, CACNA1H, SLC5A10, SEC61A1, AATK PTK2, CALY, GRIK5, RHOF NOXA1, TBC1D5, ASAP2, TBC1D22A, TBC1D9B TBC1D5, ASAP2, MGC166429, RAPGEF1, TBC1D22A, TBC1D9B TBC1D5, ASAP2, MGC166429, TBC1D22A, TBC1D9B TBC1D5, ASAP2, MGC166429, RAPGEF1, TBC1D22A, TBC1D9B PTK2, GRB2, SQSTM1, BAIAP2 ACTB, PGS1, ADSSL1, TDRD9, ATP1A3, MAPK11, PDE6G, TPK1, AKT1, EPHA4, MAPK12, PARS2, ENTPD8, RUVBL1, EEFSEC, RHOF, UBE2T, DHCR24, AATK ACTB, PGS1, TDRD9, ATP1A3, MAPK11, PDE6G, TPK1, AKT1, EPHA4, MAPK12, PARS2, ENTPD8, RUVBL1, UBE2T, DHCR24, AATK ACTB, PGS1, TDRD9, ATP1A3, MAPK11, PDE6G, TPK1, AKT1, EPHA4, MAPK12, PARS2, ENTPD8, RUVBL1, UBE2T,

8.60E-01

8.61E-01

8.80E-01

8.85E-01

9.00E-01

8.98E-01

9.40E-01 3.20E-02

9.37E-01 3.23E-02

4.40E-02

4.38E-02

4.50E-02

4.52E-02

4.90E-02

4.92E-02

6.30E-02 6.80E-02

6.27E-02 6.80E-02

7.20E-02

7.18E-02

7.50E-02

7.46E-02

62!

DHCR24, AATK

!

GO:0032553

ribonucleotide binding

GO:0032555

purine ribonucleotide binding

GO:0000166

nucleotide binding

GO:0030554

adenyl nucleotide binding

GO:0003700

transcription factor activity

GO:0005524

ATP binding

GO:0032559

adenyl ribonucleotide binding

GO:0008083 GO:0016563 GO:0030528

growth factor activity transcription activator activity transcription regulator activity

GO:0005509

calcium ion binding

ACTB, PGS1, ADSSL1, TDRD9, ATP1A3, MAPK11, PDE6G, TPK1, AKT1, EPHA4, MAPK12, PARS2, ENTPD8, RUVBL1, EEFSEC, RHOF, UBE2T, AATK ACTB, PGS1, ADSSL1, TDRD9, ATP1A3, MAPK11, PDE6G, TPK1, AKT1, EPHA4, MAPK12, PARS2, ENTPD8, RUVBL1, EEFSEC, RHOF, UBE2T, AATK ACTB, PGS1, ADSSL1, SETD1B, TDRD9, ATP1A3, MAPK11, PDE6G, TPK1, AKT1, EPHA4, NAV1, MAPK12, PARS2, ENTPD8, RUVBL1, EEFSEC, RHOF, UBE2T, DHCR24, AATK ACTB, PGS1, TDRD9, ATP1A3, MAPK11, TPK1, AKT1, EPHA4, MAPK12, PARS2, ENTPD8, RUVBL1, UBE2T, DHCR24, AATK MSX2, PPARA, STAT5A, TBX4, STAT5B, NR4A2, STAT3, NFATC1 ACTB, PGS1, TDRD9, ATP1A3, MAPK11, TPK1, AKT1, EPHA4, MAPK12, PARS2, ENTPD8, RUVBL1, UBE2T, AATK ACTB, PGS1, TDRD9, ATP1A3, MAPK11, TPK1, AKT1, EPHA4, MAPK12, PARS2, ENTPD8, RUVBL1, UBE2T, AATK FGF18, FOXJ1, CSF1 PPARA, NR4A2, STAT3 MSX2, PPARA, STAT5A, TBX4, STAT5B, HDAC10, NR4A2, STAT3, NFATC1 STAT5A, SCUBE1, ENTPD8, STAT5B, CELSR1, STAT3, TBC1D9B

8.30E-02

8.30E-02

8.30E-02

8.30E-02

9.40E-02

9.38E-02

1.20E-01

1.17E-01

1.20E-01

1.24E-01

1.40E-01

1.38E-01

1.40E-01

1.45E-01

2.10E-01 2.60E-01 3.30E-01

2.07E-01 2.65E-01 3.35E-01

3.60E-01

3.57E-01

63!

GO:0016879

GO:0032561 GO:0019001 GO:0004672

ligase activity, forming carbonnitrogen bonds enzyme binding protein serine/threonine kinase activity guanyl ribonucleotide binding guanyl nucleotide binding protein kinase activity

GO:0043565 GO:0046983 GO:0008092 GO:0003723 GO:0003677

sequence-specific DNA binding protein dimerization activity cytoskeletal protein binding RNA binding DNA binding

GO:0042802 GO:0005525 GO:0008270

identical protein binding GTP binding zinc ion binding

GO:0046914

transition metal ion binding

GO:0019899 GO:0004674

KEGG_PA THWAY

!

bta04370

VEGF signaling pathway

bta04660 bta04012 bta05200

T cell receptor signaling pathway ErbB signaling pathway Pathways in cancer

bta04010

MAPK signaling pathway

ADSSL1, UBE2T, TTLL12

3.90E-01

3.89E-01

SQSTM1, HDAC10, STAT3 AKT1, MAPK12, MAPK11, AATK

4.70E-01 4.80E-01

4.65E-01 4.78E-01

ADSSL1, EEFSEC, PDE6G, RHOF ADSSL1, EEFSEC, PDE6G, RHOF AKT1, EPHA4, MAPK12, MAPK11, AATK MSX2, PPARA, NR4A2, NFATC1 CSF1, NR4A2, STAT3 BAIAP2, CALD1, FSCN1 NPM1, RPUSD1, EEFSEC, SRP9 MSX2, PPARA, TRMU, STAT5A, TBX4, STAT5B, NR4A2, SOX8, STAT3, NFATC1 ACTB, PTPRG, CSF1 ADSSL1, EEFSEC, RHOF PPARA, NPLOC4, TRMU, SQSTM1, ZFP90, ZNF296, NR4A2, ASAP2, HAGHL, ADAM8 PPARA, NPLOC4, TRMU, POMGNT1, SQSTM1, ZFP90, ZNF296, NR4A2, ASAP2, HAGHL, ADAM8, HPD AKT1, PTK2, MAPK12, MAPK11, NFATC2, NFATC1 AKT1, MAPK12, GRB2, MAPK11, NFATC2, NFATC1 AKT1, PTK2, GRB2, STAT5A, STAT5B AKT1, FGF18, WNT7B, PTK2, RASSF5, GRB2, STAT5A, STAT5B, STAT3 PTPN7, AKT1, FGF18, MAPK12, GRB2, CACNA1H, MAPK11, NFATC2

5.10E-01 5.10E-01 5.50E-01

5.08E-01 5.15E-01 5.49E-01

5.60E-01 6.00E-01 6.00E-01 6.20E-01 6.30E-01

5.62E-01 6.02E-01 6.02E-01 6.18E-01 6.25E-01

6.70E-01 7.40E-01 9.00E-01

6.72E-01 7.44E-01 8.99E-01

9.30E-01

9.30E-01

1.30E-03

1.30E-03

6.40E-03

6.37E-03

1.10E-02 2.00E-02

1.14E-02 1.97E-02

2.50E-02

2.49E-02

64!

bta04670 bta04360 bta04662 bta04062

B cell receptor signaling pathway Chemokine signaling pathway

bta04722

Neurotrophin signaling pathway

bta04664 bta05220 bta05223 bta04510 bta04920

Fc epsilon RI signaling pathway Chronic myeloid leukemia Non-small cell lung cancer Focal adhesion Adipocytokine signaling pathway Tight junction Regulation of actin cytoskeleton Renal cell carcinoma Insulin signaling pathway Wnt signaling pathway Progesterone-mediated oocyte maturation GnRH signaling pathway Toll-like receptor signaling pathway Natural killer cell mediated cytotoxicity Purine metabolism Neuroactive ligand-receptor interaction

bta04530 bta04810 bta05211 bta04910 bta04310 bta04914 bta04912 bta04620 bta04650 bta00230 bta04080

!

Leukocyte transendothelial migration Axon guidance

ACTB, PTK2, RASSF5, MAPK12, MAPK11 EPHA4, PTK2, PLXNB2, NFATC2, NFATC1 AKT1, GRB2, NFATC2, NFATC1

3.70E-02

3.73E-02

3.90E-02

3.94E-02

4.30E-02

4.27E-02

AKT1, PTK2, GRB2, STAT5B, GNG13, STAT3 AKT1, MAPK12, GRB2, MAPK11, RAPGEF1 AKT1, MAPK12, GRB2, MAPK11 AKT1, GRB2, STAT5A, STAT5B AKT1, RASSF5, GRB2 AKT1, ACTB, PTK2, GRB2, RAPGEF1 AKT1, PPARA, STAT3

4.30E-02

4.32E-02

4.40E-02

4.39E-02

4.90E-02 5.10E-02 1.10E-01 1.50E-01 1.60E-01

4.92E-02 5.08E-02 1.10E-01 1.50E-01 1.59E-01

AKT1, ACTB, EPB41L3, CTTN ACTB, FGF18, ENAH, PTK2, BAIAP2 AKT1, GRB2, RAPGEF1 AKT1, EXOC7, GRB2, RAPGEF1 WNT7B, RUVBL1, NFATC2, NFATC1 AKT1, MAPK12, MAPK11

1.60E-01 1.70E-01 1.70E-01 1.70E-01 2.20E-01 2.30E-01

1.60E-01 1.67E-01 1.68E-01 1.68E-01 2.17E-01 2.34E-01

MAPK12, GRB2, MAPK11 AKT1, MAPK12, MAPK11

2.70E-01 2.90E-01

2.68E-01 2.89E-01

GRB2, NFATC2, NFATC1

3.30E-01

3.35E-01

ADSSL1, ENTPD8, PDE6G SSTR5, TSPO, GRM7, GRIK5

5.10E-01 5.10E-01

5.08E-01 5.14E-01

65!

!

CHAPTER 2

QUANTITATIVE TRAIT LOCI MAPPING FOR CONJUGATED LINOLEIC ACID, VACCENIC ACID AND Δ 9-DESATURASE IN ITALIAN BROWN SWISS DAIRY CATTLE USING SELECTIVE DNA POOLING

M.G. Strillacci*1, E. Frigo*1, F. Canavesi*1, Y. Ungar§1, F. Schiavini*#, L. Zaniboni*, L. Reghenzani*, M.C. Cozzi*, A.B. Samoré*, Y. Kashi§, E. Shimoni§, R. Tal-Stein†, M. Soller†, E. Lipkin†, A. Bagnato*# *Department of Health, Animal Science and Food Safety (VESPA), University of Milan, Via Celoria 10, 20133, Milan, Italy. #Genomic and Bioinformatics Platform, University of Milan, c/o Fondazione Filarete, Viale Ortles 20, 20100 Milano, Italy. †Department of Genetics. The Hebrew University of Jerusalem, 91904 Jerusalem, Israel. §Israel Institute of Technology (Technion), Department of Biotechnology and Food Engineering, Technion City, Haifa 3200003, Israel

Published in Animal genetics, 2014: 45, 485–499. doi 10.1111/age.12174

!

66!

!

2.1. ABSTRACT A selective DNA pooling approach was applied to identify QTLs for conjugated linoleic acid, vaccenic acid and Δ9-Desaturase milk content in Italian Brown Swiss dairy cattle. Milk samples of 60 animals with higher values (after correction for environmental factors) and 60 animals with lower values for each of these traits from each of five half-sib families were pooled separately. The pools were genotyped using the Illumina Bovine SNP50 BeadChip. Sire allele frequencies were compared between high and low tails at sire and marker level for SNPs for which the sires were heterozygous. An R procedure was implemented to perform data analysis in a selective DNA pooling design. A correction for multiple tests was applied using the proportion of false positives among all test results. BTA 19 showed the largest number of markers in association to CLA. Associations among between SNPs and the traits VA and Δ9-Desaturase were found on several chromosomes. A bioinformatics survey identified genes with an important role in pathways for milk fat and fatty acids metabolism within 1 Mbp of SNP markers associated with fatty acids contents. Acknowledgments: This study was part of the QuaLAT project supported by Regione Lombardia (Project n. 837).

2.2. INTRODUCTION The detection of genomic regions affecting complex traits has led the interest in using dense panels of single nucleotide polymorphisms (SNPs) to identify quantitative trait loci (QTL) (Goddard & Hayes, 2009). Selective DNA pooling (SDP) is an experimental design that is able to reduce costs in genomic studies by genotyping pooled DNA samples from selected individuals at each of the two phenotypic extremes of a sample (Darvasi & Soller, 1994). The test to identify markers in association with a QTL is based on the difference of marker allele frequencies between the pools of individuals at the two tails of the phenotypic distribution. Theoretical analysis shows that for experiments involving backcross, F2 and half-sib designs, SDP power to detect genes with large effect, is comparable to individual selective genotyping (Darvasi & Soller, 1994). Milk contains a number of micro-components having nutraceutical properties with beneficial effect on human health. Among these compounds, conjugated linoleic acid (CLA) is one of the most relevant. Bauman & Lock (2006), Benjamin & Spener (2009) reported that studies with animal models have demonstrated a variety of beneficial health !

67!

!

effects from CLA, including anti-carcinogenic, anti-atherogenic, anti-obesity, immune system enhancement and anti-diabetic effect. Although in recent studies the biological effects of CLA results are controversial, many of its benefits related to the diet supplementation

were

confirmed

(Oleszczuk

et

al.,

2012).

CLA

represents

a

heterogeneous group of positional and geometric isomers of linoleic acid with a conjugated double bond system. These are produced as transient intermediates in a rumen enzymatic biohydrogenation of unsaturated fatty acids consumed in the diet. The vaccenic acid (VA) (C18:1 trans-11) is the major biohydrogenation intermediate produced in the rumen and 75-90% of it is converted into CLA (C18:2 cis-9, trans-11) by Δ9Desaturase (D9D) in the mammary gland and other tissues (Bauman & Lock, 2006). The role of rumen biohydrogenation and tissue D9D in the production of CLA in milk fat and in other tissues is represented in Figure 1 adapted from Bauman & Lock (2006). Genetic analyses of bovine milk fatty acids in several populations have shown heritability of 0.12, 0.12 to 0.21, and 0.15 for VA, CLA and D9D, respectively (Stoop et al, 2008; Mele et al., 2009). The identification of genomic regions that may be responsible for genetic variation in milk fat composition could help in understanding the genetic basis of the biological pathways involved in fatty acid synthesis and thus, may create opportunities for selection for milk nutraceutical components. A number of studies identified QTLs affecting bovine milk fatty acids composition. Morris et al. (2007) identified QTLs for VA and CLA on BTA19 in a linkage analysis using microsatellite markers. Schennink et al. (2009) in a GWAS analysis using SNP markers, found QTLs for CLA (BTA11, BTA14 and BTA17), VA (BTA1, BTA11, BTA18 and BTA27) and D9D (BTA1, BTA6, BTA14, BTA16 and BTA19). Moreover, Bouwman et al. (2011) identified QTLs for CLA on BTA6, BTA7, BTA14, BTA17, BTA19, BTA26, BTA27 and BTA28. All of these results are reported in AnimalQTLdb (http://www.animalgenome.org). The purpose of the present study was to verify the existence of genetic variability related to the major actors involved in the CLA synthesis in the mammary gland in cattle. Hence, the variation of VA level as substrate for the D9D activity, of D9D as the indicator of the efficiency of the enzymatic activity and of CLA as the product of the efficiency of the endogenous synthesis of VA by the D9D, were studied biometrically. In addition, a QTL mapping analysis for CLA, VA and D9D in Italian Brown Swiss dairy cattle, with a selective DNA pooling in a daughter design (Lipkin et al. 1998) using the Illumina Bovine SNP50 BeadChip was performed.

!

68!

!

2.3. MATERIALS AND METHODS 2.3.1. Sampling of families Five large Italian Brown Swiss half-sib sire families (denoted B, C, E, F, G as per Bagnato et al. 2008) were used in this study. Milk samples were collected and stored from previous studies (Bagnato et al. 2008) and were available for further analyses. The number of milk samples available for each of the 5 families is reported in Table 1. Semen samples of the sires for genotyping were provided by the Italian Brown Cattle Breeders Association semen bank. Milk samples of about 500 available daughters for each family (total 2,601 samples) were used for milk fatty acids determination and for D9D calculation, and as a source of DNA from Somatic Cells. 2.3.2. Fatty acids determination Milk fat was extracted and transmethylated according to Chouinard et al. (1999). Fatty acid methyl esters were analyzed by gas chromatography (GC-FID) with a highly polar 100 m SP-2560 column, using GLC-60. An indirect measurement of D9D was used, calculated as the ratio of milk CLA to the sum of milk CLA and VA, as described by Bauman & Lock (2006), Conte et al. (2010) and Schennink et al. (2008). 2.3.3. Variance components analysis (Co)variance components for fatty acids were estimated using the VCE 6.0 package (Groeneveld et al., 2010; Neumaier & Groeneveld, 1998). Environmental factors included in the model of analysis for variance components estimation were previously tested for their significance with the GLM procedure of SAS®. Pedigree information were provided by the Herd Book of ANARB and included all known ancestors for a total of 8,604 animals. The following single trait animal model was used to obtain estimates of heritabilities for VA, CLA and D9D: yijklmnp= µ + Pi + AGj + YMk + Sl + DIMm + PRn + ap + eijklmnp where: yijklmnp is the value of VA, CLA or D9D determined for each daughter milk sample; µ is the factor common to all observations; Pi (i=1,…4) is the fixed effect of the class of parity; AGj (j=1,…4) is the fixed effect of class age at calving;

!

69!

!

YMk (k=1, ….16) is the fixed effect of the interaction between year and month of calving; Sl (l=1,…4) is the fixed effect of the season of calving; DIMm (m=1,…15) is the fixed effect of the class of days in milk; PRn (n=92) is the fixed effect of province; ap is the random additive genetic effect of the animal p (0, As2a); eijklmnp is a random residual (0, Is2e). Parity was classified into 4 classes for first, second, third and later parities. Age at calving was classified into 4 classes (class 1: from 18 to 42 months, class 2: from 42 to 54 months, class 3: from 54 to 66 months, class 4: ≥ 67 months). Season effect was classified in 3-mo classes (1=spring; 2=summer; 3=autumn; 4=winter). Days in milk were grouped in 30-days classes (15 classes). 2.3.4. Pools constitution The residual values (phenotypes adjusted for all environmental factors) for the three traits VA, CLA and D9D, obtained from a GLM analysis with the same fixed effect of the variance component estimation model described above (no additive genetic effect), were used to identify the 60 more extreme daughters in the high and low tails of the trait distribution within each family/trait combination. Thus, for each trait, a total of 120 daughters were identified for each family. The selected samples for each tail (high and low values respectively for VA, CLA and D9D) were divided (even and odd sample numbers) into 2 sub-pools of 30 individuals each, in order to have two sub-pools with comparable phenotypic value. Hence, a total of 4 pools were constructed for each family/trait combination, for a total of 20 pools per trait (60 pools across all the three traits). The milk of each individual was included in the pools in different volumes according to Somatic Cell Count (SCC), ensuring that DNA of all individuals was equally represented within each pool. SCC were available from routine milk sampling, or determined by Somacount 150 (Bentley instrument, Chaska, MN). Each sub-pools contained a total of 40,000 cells. 2.3.5. DNA extraction and genotyping Milk pools were treated according to Murphy et al. (2002) to obtain a clear pellet of cells; genomic DNA was then extracted utilizing NucleoSpin® Blood kit (Macherey-Nagel, GmbH & Co. KG). Genomic DNA was also extracted from semen using the ZR Genomic DNA TM Tissue MiniPrep (Zymo Research, Irvine, CA). !

70!

!

DNA samples were quantified using NanoQuant Infinite m200 (Tecan) and diluted to 50 ng/ul. A Quality Control (QC) was performed on each sample to verify the DNA integrity on Invitrogen E-Gel 1% Agarose Gel. DNA samples were genotyped using Illumina Bovine SNP50 BeadChip interrogating 54,001 SNPs. 2.3.6. Statistical analyses Statistical analysis of pools. Pools were analyzed according to the SDP approach in a daughter design (Darvasi & Soller, 1994; Bagnato et al., 2008). Statistical analyses were performed with respect to SNP markers for which the sires were heterozygous, as these were the only ones that could segregate alternative sire alleles within family linked to a QTL for the trait of interest. Frequency estimates. The estimation of allele frequency in DNA pools is one of the critical steps in DNA pooling analysis, especially with SNP chips (Janicki & Liu, 2009). These authors demonstrated the validity of the B-allele frequency, calculated by the BeadStudio software from Illumina, as a good estimator of the allele frequency of the individuals that are part of a pool. In the present study, the generation of B-allele frequency was performed using the selfnormalization algorithm of Illumina BeadStudio software (Genotyping Module v3.2) as suggested by Janicki & Liu (2009). The marker-sire-trait test. A pipeline in R software (http://www.r-project.org/) was programmed to perform a single-marker sire test. In SDP, significance of marker j for a single sire i, heterozygous at marker j, was determined for each trait by the single-sire test statistic (Darvasi & Soller, 1994; Lipkin et al., 2008; Bagnato et al., 2008). Briefly, a test statistic for the ijth sire × marker combination was calculated as: Zij=Dtestij/SD(Dnullij) where Dtestij = [(H1 + H2) − (L1 + L2)]/2 is the difference in sire allele frequencies between the high and low daughters pools of the ith sire with respect to the jth marker, averaged over the two subpools of the same tail. Dnullij = [(H1 − H2) + (L1 − L2)]/2 is the difference in allele frequencies between the 2 subpools of the same tail of the ith sire with respect to the jth marker, averaged over the high and low pools.

!

71!

!

Dtestij and Dnullij were calculated only for markers for which the sire was heterozygous. Because Dnullij is calculated within tails, it has expectation of 0 and thus should distribute as the D under the null hypothesis of no QTL effecting linkage to the marker. Thus, the standard deviation (SD) of the Dnullij values obtained across all markers [SD(Dnullij)] is an empirical estimate of the standard error of Dtestij under the null hypothesis. Under the null hypothesis, Zij values distribute as a standardized normal variable and Pvalues for the individual sire-marker combinations were obtained accordingly. The test statistic (TSj) for the jth marker was then calculated by summing the Z2ij across all heterozygous sires: TSj=∑(Z2ij) Under the null hypothesis, TSj distributes as chi-square with degrees of freedom (df) equal to k, where k is the number of sires heterozygous at the marker (Lipkin et al., 1998). The comparison wise error rate P-values for the jth marker (CWER-P) were obtained accordingly. Quality control. Dnull for each pool was computed as the difference in allele frequency estimates between replicate pools in the same tail. As such, it should represent the distribution of D under the null hypothesis. Anderson-Darling, Shapiro-Wilk and Kolmogorov-Smirnov normality tests were performed on Dnull distribution within and across sires (Stephens, 1986; Royston, 1995; Marsaglia et al., 2003). The quantiles of the observed p-values corresponding to the Dnull values were compared with the quantiles of the standard normal distribution using a quantile-quantile plot (Q-Q plot) to visually assess the quality of data distribution. The distribution of actual allele frequency differences within and across tails was analyzed in order to identify SNPs with unexpected variability within tail (Bagnato et al., 2008; Huang et al, 2010) and possible outlier pools whose estimated allele frequencies deviated within tails over many markers. All SNPs that showed a significant allele frequency difference at p-value ≤0.01 within tail of the tested distribution (2.33 SD), were excluded from the analysis. These represented SNPs whose allele frequency estimations could be linked to errors of various sources (Bagnato et al., 2008; Huang et al., 2010). One pool for the high CLA tail in family B was entirely excluded from the analysis. An additional quality control step was to identify SNPs with at least 10 bead score reads that are the base for the estimation of pooling allele frequency (PAF) used to compute B-allele frequencies by

!

72!

!

Illumina BeadStudio (McGregor et al,. 2008). All SNPs that did not have at least 10 PAF within pool were removed from the analysis. Correction for multiple tests. A second Q-Q plot was used to assess the number and magnitude of observed linkage between SNPs and the traits under study, comparing the linkage statistics expected under the null hypothesis of no linkage and the observed -log10(p-value). A multiple-test correction was applied using the proportion of false positives (PFP). As illustrated by Fernando et al. (2004), PFP was computed as:

where P0, the proportion of true null hypothesis among all hypotheses tested, is estimated as proposed by Mosig et al. (2001), using a R routine developed by Nettleton et a,. (2006), α is the set significance level (0.05; 0.10 or 0.20), K is the number of tests and Rα denotes the observed number of rejected null hypothesis at the set significance level. As reported by Fernando et al. (2004), PFP is the estimator that Mosig et al. (2001) called "adjusted false discovery rate (FDR)". The corresponding threshold for PFP levels of 5, 10 and 20% were determined. Using the -log10 of the linkage test p-values for each SNP, Manhattan plots were created for each trait. Bioinformatics. A list of genes with an important role in pathways for milk fat and fatty acids metabolism was generated using Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.ad.jp/kegg/pathway.html). Bos_taurus_UMD_3.1 assembly in NCBI, ENSEMBL and UCSC databases were used in order to verify which of the significant SNPs were close (within 1 Mb) to one of these genes. 2.4. RESULTS AND DISCUSSION A total of 1,482 milk samples were successfully analysed by gas chromatography GC-FID. Descriptive statistics are reported in Table 2 where means, residual values for each trait within each family, are reported in high and low tails for the sub-pools. Means for CLA were higher than those reported by Kelsey et al. (2003) and De Marchi et al. (2011) in US !

73!

!

and Italian Brown Swiss cattle, while values for VA and D9D were similar to those reported by Kelsey et al. (2003). Moderate heritability values were estimated for VA (0.33) and CLA (0.37). CLA heritability was similar to that reported by Stoop et al. (2008). Because CLA is a recognized bioactive food component of milk fat, the existence of genetic variability of this fatty acid shows that the nutritional properties of milk fat can be improved by selective breeding. D9D heritability was 0.38, confirming a genetic variability related to the enzyme activity. A total of 13,533, 14,560, 14,389, 13,447 and 13,325 SNPs, for which the sires were heterozygous, were analysed for family B, C, E, F, G, respectively. Figure 2 shows the Q-Q plots of the observed and expected p-values of sire markers for CLA, VA and D9D. Data appeared to follow approximately a normal distribution, deviating from it only at the two extremes of the regression line. Across all traits, the mean value of Dnull at sire level was equal to zero as expected. Observations at the extreme of the observed distribution showed values that were slightly smaller than expected. Thus, Dnull distributes as a standard normal distribution with mean zero, confirming that Dnull indeed represents D under the null hypothesis. The values of SD of Dnull were 0.149, 0.163 and 0.147 for CLA, D9D and VA, respectively. Figure 3 shows the Q-Q plots, comparing, for each trait, the number and magnitude of observed linkage test p-values across all sires x heterozygous-marker combinations, and the test distribution expected under the null hypothesis of no QTL linkage. Marked deviations from the identity line suggest that the samples contain many values arising from truly falsified null-hypothesis tests. According to PFP corrections adopted, different thresholds levels of –log10(p-values) significance were obtained and applied to Manhattan plots (Figure 4) for each trait. The PFP thresholds (5%, 10%, 20%) were different in the Manhattan plots for CLA, VA and D9D. In particular, p-values corresponding to 5% PFP were 1.5E-4, 1.0E-5, and 1.2E-5 respectively for CLA, VA and D9D; values corresponding to 10% PFP were 1.1E-3, 1.0E4, and 5.0E-5 respectively; and values corresponding to 20% PFP were 6.6E-3, 7.2E-4, and 1.7E-3 respectively. Each point in the Manhattan plots is a SNP set out across the chromosome from left to right, and the heights correspond to the strength of the association to the analysed trait. Figure 5, Figure 6 and Figure 7 illustrate significant markers at different PFP for CLA, VA and D9D, showing the region in each chromosome where the markers were associated with putative QTL.

!

74!

!

2.4.1. Association tests of significant SNPs considering PFP threshold of 5% Table 3 shows for each trait, the significant SNPs located above the 5% PFP threshold, their chromosomal positions and p-values. A total of 73, 6, and 7 SNPs were significant for CLA, VA and D9D at 5% PFP. These significant markers were distributed over BTAs 5, 7 and 21. Only a single marker, BTA-38242-no-rs on BTA16, was significant for more than 1 trait (CLA and VA). On BTA19 no less than 21 markers were significant for CLA (the next significant chromosome was 17 with only 10 significant markers). Also shown in Table 3 is whether the significant marker is intragenic, within 1 Mbp of an annotated gene (independently of is function), or not close to a known gene. We will not discuss in detail in this paper all of the chromosomal regions associated with the traits considered. What follows are some selected regions that showed associations with the most studied metabolic pathways in literature. Most of the regions included in Table 3 have significant effects on predisposition to cancer in humans (e.g.: PCDH10, MYC, AATF) (Wang et al., 2009; Kaul & Mehrotra, 2007). Also, several SNPs on different BTAs are significantly associated with genes involved in human neurodegenerative diseases (e.g.: ATXN10, NSF, RIMBP2) (Wardle et al., 2009; Liu et al., 2011; Hollingworth et al., 2012) and hypertension (e.g.: KCNA5) (Wipff et al., 2010). Table 4 shows significant SNPs located above the 5% PFP threshold line of the Manhattan plots within 1 Mbp from genes encoding for enzymes with an important role in fat and fatty acid metabolism. Genes near significant SNPs for the three traits are here commented separately. CLA - On BTA 2, at 98.4 Mbp, ACADL gene was found close to the ARS-BFGL-NGS-3990 SNP (98.2 Mbp) that was significantly associated to CLA amount in milk. This gene encodes for acyl-CoA dehydrogenase long-chain that is involved in several metabolic pathways, including fatty acid metabolism and the peroxisome proliferation-activated receptors (PPARs) signalling pathway that has a strategic role in increased adipogenesis and fatty acid storage. On BTA 4, at 101.8 Mbp, DGKI gene encodes for diacylglycerol kinase-iota, which is involved in glycerophospholipid and glycerolipids metabolism. The major chromosomal regions that showed highly significant associations with CLA were on BTA 19: SNPs close to the ACACA gene (13.7 Mbp, involved in fatty acid biosynthesis) were found significantly associated to CLA phenotypic variation. In the region located at 30-44 Mbp, where SNPs were found associated to the trait, genes involved in the biosynthesis of milk fat, including sterol regulatory element binding transcription factor 1 (SREBF1 at 35.7 Mbp), citrate lyase (ACLY, at 43.4 Mbp) and signal transducer and !

75!

!

activator of transcription 5A (STAT5A, at 43.7 Mbp), are annotated and are reported by Bouwman et al. (2011). Additionally, within the same region on BTA 19, three SNPs (BTB01316060, BTB-01315978, ARS-BFGL-NGS-42430) close to ADPRM gene at 30.30 Mbp (ADP-

ribose/CDP-alcohol

diphosphatase,

manganese-dependent)

involved

in

glycerophospholipid metabolism. At 35.3 Mbp, ARS-BFGL-NGS-112923 SNP is mapped into the PEMT gene (phosphatidylethanolamine N-methyltransferase) that is involved in glycerophospholipid metabolism. Finally, two SNPs (Hapmap58303-ss46526468 and Hapmap49617-BTA-45355) were associated to the PHOSPHO1 gene at 37.9 Mbp (phosphatase, orphan 1) involved in glycerophospholipid, phospholipid, lipids and lipoproteins metabolism and biosynthesis. VA - No SNPs were found “significant” above the 5% PFP threshold line of the Manhattan plots for this trait. D9D - The region at 3.37 Mbp on BTA 28 is the region harboring GNPAT (glyceronephosphate O-acyltransferase) gene that is involved in lipids, lipoproteins and glycerophospholipid metabolism. The region at 66.1 Mbp on BTA 17 showing an association with D9D, is the region harboring ACACB (acetyl-CoA carboxylase beta) gene that is involved in lipids and lipoproteins metabolism. 2.4.2. Association tests of significant SNPs located below the 5% PFP threshold line of the Manhattan plots Tables 5 and 6 show significant SNPs located below the 5% PFP threshold line of the Manhattan plots, associated with genes (< 1 Mb) encoding for enzymes with an important role in fat and fatty acid metabolism. There was an overlap in the list of chromosomes that had the largest number of SNPs associated with CLA and D9D below the 5 % PFP threshold line of the Manhattan plots, and some chromosomal regions showed associations with VA. CLA - The major regions that showed significant associations with CLA were on BTA 19, where most of the SNPs were close to PEMT, SREBF1, STAT5A, PHOSPHO1 and ADPRM genes. Moreover, located at 51.38 Mb, mapped FASN gene that encodes for fatty acid synthase which is a multifunctional enzyme that catalyses de novo fatty acid synthesis. The region at 64.8 Mbp on BTA 13 is the region harbouring ACSS2 gene (acylCoA synthetase short-chain family member 2), one of the most abundant enzymes in bovine mammary tissue whose expression increased during lactation and is responsible for the activation of acetate for de novo fatty acid synthesis (Bionaz & Loor, 2008). The region on BTA 14 includes the DGAT1 gene (diacylglycerol O-acyltransferase 1), which is !

76!

!

known to influence milk production traits and milk fat composition (Bouwman et al., 2011). On BTA 15, the region located at 78.3 Mbp encodes the NR1H3 (nuclear receptor subfamily 1, group H, member 3), alias LXRalpha, a nuclear hormone receptor whose activation (alone or in conjunction with SREBP gene), promotes the SCD stearoyl-CoA desaturase (D9D) gene expression in a wide range of tissue (Hebbachi et al., 2008). On BTA 26, the glycerol-3-phosphate acyltransferase mitochondrial (GPAM), is the enzyme that catalyses the initial and committed step of glycerolipids synthesis and, therefore, it is a potential site for triacylglycerol synthesis regulation (Roy et al., 2006). VA - The region at 64.95 Mbp on BTA 17 showing an association with VA, is the region harboring ALDH2 (aldehyde dehydrogenase 2 family) gene that is involved in lipids and lipoproteins metabolism. On BTA 27 the region located at 37.1 Mbp showed association with 1-acylglycerol-3-phosphate-O-acyltransferase (AGPAT6), that has been recognized as microsomal glycerol-3-phosphate acyltransferase (GPAT), which catalyzes the glycerolipids biosynthesis pathway (Bionaz & Loor, 2008). Also, AGPAT6 isoform expression is under the control of the above mentioned PPAR signalling pathway in several tissues. D9D - The major region that showed significant associations with D9D were on BTA 17. The region between 64.95-66.79 Mbp on BTA 17 is the region harboring ALDH2 (aldehyde dehydrogenase 2 family) and ACACB (acetyl-CoA carboxylase beta) genes which are involved in lipids and lipoproteins metabolism. On BTA 19, the region located at 55.7 Mbp encodes for acyl-CoA oxidase (ACOX1) that catalyse the first step of peroxisomal fatty acid β-oxidation. On BTA 26, as described for CLA, the region encoding for GPAM was associated with D9D. 2.4.3. Pathways Several metabolic lipid pathways, according to KEGG database, were identified for the genes associated with SNPs located within 5-20% PFP threshold (Tables 3-4-5), and they are represented in Figure 8. For VA, D9D and CLA, the most frequent pathways were the metabolism of lipids and lipoproteins, the glycerophospholipid and fatty acid metabolism and the triacylglycerol biosynthesis. 2.5. CONCLUSIONS Using a selective DNA pooling approach a QTL mapping was performed for CLA, VA and D9D, resulting in various genomic associated regions. In particularly, on BTA 19 there

!

77!

!

were several genes involved in CLA synthesis, while for VA and D9D the significant SNPs were distributed over all the chromosomes. This is the first mapping for fatty acids contents in Italian Brown Swiss cattle. The results may allow improving milk fat composition using breeding selection based on genomic merit of cows for milk fat composition. The identification of genomic regions that may be responsible for genetic variation in milk fat composition will help understanding the biological pathways involved in fatty acid synthesis and relevant markers can be added to SNP prediction equations. The possibility to calculate prediction equations for fatty acid is enhanced and made possible by the NIR technology able to phenotype milk samples from the routine milk recording system for fatty acids. The interest of farmers in enhancing the nutraceutical value of milk is growing, as the Bleu-Blanc-Coeur consortium has been successful in marketing Omega 3 naturally enriched milk. The Italian Brown Swiss breed is currently having a specific consortium for marketing cheese produced only from Brown Swiss milk. An additional specialized product may be attractive to consumers, especially in short production to consumer chains, as often found in alpine areas. 2.6 REFERENCES - Bagnato A., Schiavini F., Rossoni A., Maltecca C., Dolezal M., Medugorac I., Sölkner J., Russo V., Fontanesi L., Friedmann A. , Soller M. & Lipkin E. (2008) Quantitative Trait Loci Affecting Milk Yield and Protein Percent in a 3 Countries Brown Swiss Population. Journal of Dairy Science 91, 767-783. - Bauman D.E. & Lock A.L. (2006) Conjugated Linoleic Acid: Biosynthesis and Nutritional Significance. In: Advanced Dairy Chemistry, Lipids (ed. by P.F. Fox, & P.L.H. McSweeney) Vol. 2, pp 93-136, Springer US. - Benjamin S. & Spener F. (2009) Conjugated linoleic acids as functional food: an insight into their health benefits. Nutr Metab 18, 6-36. - Bionaz M. & Loor J.J. (2008) Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genomics 9, 366-387. - Bouwman A.C., Bovenhuis H., Visker M.H. & Van Arendonk J.A. (2011) Genome-wide association of milk fatty acids in Dutch dairy cattle. BMC Genetics 12, 43. - Chouinard P.Y, Corneau L., Barbano D.M., Metzger L.E & Bauman D.E. (1999) Conjugated linoleic acids alter milk fatty acid composition and inhibit milk fat secretion in dairy cows. The Journal of Nutrition 129 (8), 1579-1584. !

78!

!

- Conte G., Mele M. Chessa S., Castiglioni B., Serra A., Pagnacco G., Secchiari P. (2010) Diacylglycerol acyltransferase 1, stearoyl-CoA desaturase 1, and sterol regulatory element binding protein 1 gene polymorphisms and milk fatty acid composition in Italian Brown cattle. Journal of Dairy Science 93(2), 753-763. - Darvasi A. & Soller M. (1994) Selective DNA pooling for determination of linkage between a molecular marker and a quantitative trait locus. Genetics 138, 1365-1373. - De Marchi M., Penasa M., Cecchinato A., Mele M., Secchiari P. & Bittante G.(2011) Effectiveness of mid-infrared spectroscopy to predict fatty acid composition of Brown Swiss bovine milk. Animal 5, 1653-1658. - Fernando R., Nettleton L., Southey B.R., Dekkers J.C.M., Rothschild M. & Soller M. (2004) Controlling the proportion of false positive (PFP) in a multiple test situation. Genetics 166, 611-619. - Goddard M.E. & Hayes B.J. (2009) Mapping genes for complex traits in domestic animals and their use in breeding programmes. Nature Reviews Genetics 10, 381–391. - Groeneveld E., Kovac M. & Mielenz N. (2010) VCE User’s Guide and Reference Manual Version 6.0. - Hebbachi A.M., Knight B.L., Wiggins D., Patel D.D. & Gibbons G.F. (2008) Peroxisome proliferator-activated receptor alpha deficiency abolishes the response of lipogenic gene expression to re-feeding: restoration of the normal response by activation of liver X receptor alpha. The Journal of Biological Chemistry 283, 4866-4876. - Hollingworth P., Sweet R., Sims R., Harold D., Russo G., Abraham R., Stretton A., Jones N., Gerrish A., Chapman J., Ivanov D., Moskvina V., Lovestone S., Priotsi P., Lupton M., Brayne C., Gill M., Lawlor B., Lynch A., Craig D., McGuinness B., Johnston J., Holmes C., Livingston G., Bass N.J., Gurling H., McQuillin A.; the GERAD Consortium; the National Institute on Aging Late-Onset Alzheimer's Disease Family Study Group, Holmans P., Jones L., Devlin B., Klei L., Barmada M.M., Demirci F.Y., Dekosky S.T., Lopez O.L., Passmore P., Owen M.J., O'Donovan M.C., Mayeux R., Kamboh M.I. & Williams J. (2012) Genome-wide association study of Alzheimer's disease with psychotic symptoms. Molecular Psychiatry 17,1316-1327. - Huang W., Kirkpatrick B.W., Rosa G.J.M. & Khatib H. (2010) A genome-wide association study using selective DNA pooling identifies candidate markers for fertility in Holstein cattle. Animal Genetics 41, 570–578. - Janicki P.K & Liu J. (2009) Accuracy of allele frequency estimates in pool DNA analyzed by high-density Illumina Human 610-Quad microarray. The Internet Journal of Genomics and Proteomics 5, 1. !

79!

!

- Kaul D. & Mehrotra A. (2007) Functional characterization of AATF transcriptome in human leukemic cells. Molecular and Cellular Biochemistry 297, 215-220. - Kelsey J.A., Corl B.A., Collier R.J. & Bauman D.E. (2003) The effect of breed parity and stage of lactation on conjugated linoleic acid (CLA) in milk fat from dairy cows. Journal of Dairy Science 86, 2588-2597. - Lipkin E., Mosig M.O., Darvasi A., Ezra E., Shalom A., Friedmann A. & Soller M. (1998) Mapping loci controlling milk protein percentage in dairy cattle by means of selective milk DNA pooling using dinucleotide microsatellite markers. Genetics 149, 1557–1567. - Lipkin E., Tal-Stein R., Friedmann A. & Soller M. (2008) Effect of quantitative trait loci for milk protein percentage on milk protein yield and milk yield in Israeli Holstein dairy cattle. Journal of Dairy Science 91,1614-1627. - Liu X., Cheng R., Verbitsky M., Kisselev S., Browne A., Mejia-Sanatana H., Louis E.D., Cote L.J., Andrews H., Waters C., Ford B., Frucht S., Fahn S., Marder K., Clark L.N. & Lee J.H. (2011) Genome-wide association study identifies candidate genes for Parkinson's disease in an Ashkenazi Jewish population. BMC Medical Genetics 12, 104. - Macgregor S, Zhao Z.Z, Henders A., Nicholas M.G., Montgomery G.W. & Visscher P.M. (2008) Highly cost-efficient genome-wide association studies using DNA pools and dense SNP arrays. Nucleic Acids Research 36, e35. - Marsaglia G., Tsang W.W. & Jingbo W. (2003) Evaluating Kolmogorov's distribution. Journal of Statistical Software 8/18. - Mele M., Dal Zotto R., Cassandro M., Conte G., Serra A., Buccioni A., Bittante G. & Secchiari P. (2009) Genetic parameters for conjugated linoleic acid, selected milk fatty acids, and milk fatty acid unsaturation of Italian Holstein-Friesian cows. Journal of Dairy Science 92, 392-400. - Mosig, M.O., Lipkin E., Khutoreskaya G., Tchourzyna E., Soller M. & Friedmann A. (2001) A whole genome scan for quantitative trait loci affecting milk protein percentage in Israeli-Holstein cattle, by means of selective milk DNA pooling in a daughter design, using an adjusted false discovery rate criterion. Genetics 157, 1683–1698. - Morris C.A., Cullen N.G., Glass B.C., Hyndman D.L., Manley T.R., Hickey S.M., McEwan J.C., Pitchford W.S., Bottema C.D. & Lee M.A. (2007) Fatty acid synthase effects on bovine adipose fat and milk fat. Mammalian Genome 18, 64-74. - Murphy M.A., Shariflou M.R. & Moran C. (2002) High quality genomic DNA extraction from large milk samples. Journal of Dairy Research 69, 645–649.

!

80!

!

- Nettleton D., Hwang J.T.G., Caldo R.A. & Wise R.P. (2006) Estimating the number of true null hypotheses from a histogram of p values. Journal of Agricultural, Biological, and Environmental Statistics 11, 337-356 - Neumaier A. & Groeneveld E. (1998) Restricted Maximum Likelihood Estimation of Covariances in Sparse Linear Models . Genetics, Selection, Evolution 1(30):3–26. - Oleszczuk J., Oleszczuk L., Siwicki A.K. & Skopińska-Skopińska E. (2012) Biological effects of conjugated linoleic acids supplementation. Polish Journal of Veterinary Science 15 (2), 403-8. - Roy R., Ordovas L., Taourit S., Zaragoza .P, Eggen A. & Rodellar C. (2006) Genomic structure and an alternative transcript of bovine mitochondrial glycerol-3-phosphate acyltransferase gene (GPAM). Cytogenetic and Genome Research 112, 82-89. - Royston P., Remark AS R94 (1995) A remark on Algorithm AS 181: The W test for normality. Applied Statistics 44 547–551.Schennink A., Heck J.M., Bovenhuis H., Visker M.H., van Valenberg H.J., van Arendonk J.A. (2008) Milk fatty acid unsaturation: genetic parameters and effects of stearoyl-CoA desaturase (SCD1) and acyl CoA: diacylglycerol acyltransferase 1 (DGAT1). Journal of Dairy Science 91(5), 2135-2143. - Schennink A., Stoop W.M., Visker M.H., Van Der Poel J.J., Bovenhuis H. & Van Arendonk J.A. (2009). Genome-wide scan for bovine milk-fat composition. II. Quantitative trait loci for long-chain fatty acids. Journal of Dairy Science 92, 4676-4682. - Stephens M.A. (1986) Tests based on EDF statistics. In: D'Agostino R.B. and Stephens M.A. eds.: Goodness-of-Fit Techniques. Pp 97-123. Marcel Dekker New York. - Stoop W.M., Van Arendonk J.A., Heck J.M., van Valenberg H.J. & Bovenhuis H. (2008) Genetic Parameters for Major Milk Fatty Acids and Milk Production Traits of Dutch Holstein-Friesians. Journal of Dairy Science 91, 385–394. - Wang K.H., Liu H.W., Lin S.R., Ding D.C. & Chu T.Y.(2009) Field methylation silencing of the protocadherin 10 gene in cervical carcinogenesis as a potential specific diagnostic test from cervical scrapings. Cancer Science 100, 2175-2180. - Wardle M., Majounie E., Muzaimi M.B., Williams N.M., Morris H.R. & Robertson N.P. (2009) The genetic aetiology of late-onset chronic progressive cerebellar ataxia. A population-based study. Journal of Neurology 256, 343-348. - Wipff J., Dieudé P., Guedj M., Ruiz B., Riemekasten G., Cracowski J.L., Matucci-Cerinic M., Melchers I., Humbert M., Hachulla E., Airo P,. Diot E., Hunzelmann N., Caramaschi P., Sibilia J., Valentini G., Tiev K., Girerd B., Mouthon L., Riccieri V., Carpentier P.H., Distler J., Amoura Z., Tarner I., Degano B., Avouac J., Meyer O., Kahan A., Boileau C. & Allanore Y. (2010) Association of a KCNA5 gene polymorphism with systemic sclerosis-associated !

81!

!

pulmonary arterial hypertension in the European Caucasian population. Arthritis Rheumatism 62, 3093-100.

!

82!

!

Table 1. Number of daughters (family size) for each of the 5 families used in the analysis

Family B C E F G

Size 1,413 1,782 2,568 947 1,255

Table 2. Residual mean values and their STD for CLA, VA and D9D for each of the 5 selected Italian Brown Swiss families in the sub-pools in the low (L) and high (H) tails.

!

FAMILY

TAIL

B B B B C C C C E E E E F F F F G G G G

L1 L2 H1 H2 L1 L2 H1 H2 L1 L2 H1 H2 L1 L2 H1 H2 L1 L2 H1 H2

CLA MEAN STD -0.49390 -0.48696 0.74772 0.70672 -0.43098 -0.44452 0.66386 0.63265 -0.47744 -0.48485 130.968 127.321 -0.50308 -0.49592 0.61353 0.55806 -0.52235 -0.53004 0.20165 0.18913

0.10852 0.10104 0.70436 0.64998 0.09008 0.11882 0.52609 0.49619 0.13375 0.13695 0.44947 0.40445 0.10199 0.09206 0.56768 0.43636 0.15092 0.15388 0.23559 0.22741

D9D MEAN STD -0.14094 -0.13735 0.20718 0.20341 -0.13594 -0.12992 0.08092 0.07627 -0.14867 -0.14591 0.22401 0.2116 -0.07378 -0.06773 0.21271 0.20518 -0.18892 -0.19254 0.02299 0.01712

0.05296 0.04867 0.069 0.06599 0.05934 0.04603 0.05768 0.05099 0.04537 0.04201 0.15114 0.13075 0.07427 0.06253 0.07876 0.0693 0.07339 0.07874 0.0692 0.05935

VA MEAN

STD

-0.98427 -0.96798 0.99531 0.92021 -0.65494 -0.64364 133.338 126.801 -0.79669 -0.77258 193.435 144.863 -103.623 -102.954 0.20082 0.16536 -0.63733 -0.6152 126.227 120.646

0.17217 0.14856 0.72585 0.53167 0.17082 0.16760 0.62860 0.49839 0.30011 0.27312 282.528 0.60471 0.16730 0.16530 0.44377 0.38295 0.33431 0.31305 0.85484 0.79237

83!

!

Table 3. SNPs significant above 5% PFP threshold with their chromosomal positions, pvalues, along with symbols of genes located and Genbank used to identify the gene-SNP association. Gene and SNPs location (Mbp) as in the Bos_taurus_UMD_3.1 assembly; gene symbol as in Genbank; (*) SNP designated as in a gene; (-) not near a gene; () near gene.

Illumina SNP name CLA DPI-50 Hapmap55498-ss46527080 Hapmap44172-BTA-96950 Hapmap48236-BTA-17964 Hapmap47178-BTA-111157 ARS-BFGL-NGS-3990 Hapmap44637-BTA-17098 BTB-01240408 ARS-BFGL-NGS-113196 BTB-00218031 ARS-BFGL-NGS-12094 BTA-111858-no-rs ARS-BFGL-NGS-8730 BTB-01105737 Hapmap44668-BTA-119022 Hapmap45685-BTA-80525 ARS-BFGL-NGS-61077 ARS-BFGL-NGS-103122 Hapmap41480-BTA-20737 Hapmap59000-rs29026853 BTA-106955-no-rs ARS-BFGL-NGS-106479 ARS-BFGL-NGS-5267 ARS-BFGL-NGS-1426 ARS-BFGL-NGS-55763 Hapmap40222-BTA-65450 Hapmap50611-BTA-19865 BTB-00505587 Hapmap25446-BTC-054694 Hapmap51149-BTA-113410 BTB-00862781 BTA-38242-no-rs ARS-BFGL-NGS-27682 ARS-BFGL-NGS-19358 ARS-BFGL-NGS-17251 ARS-BFGL-NGS-14591 BTA-46636-no-rs BTA-40721-no-rs ARS-BFGL-NGS-61134 BTB-01870009 ARS-BFGL-BAC-34666 ARS-BFGL-NGS-32208 ARS-BFGL-NGS-73072 BTA-27953-no-rs Hapmap41801-BTA-21911 ARS-BFGL-NGS-116497 ARS-BFGL-NGS-114182 ARS-BFGL-NGS-6298 Hapmap51231-BTA-44563 UA-IFASA-5746 ARS-BFGL-NGS-73727 Hapmap41541-BTA-44653 ARS-BFGL-NGS-32894

!

Genbank SNP code

Bta

SNP position

P-value

Gene symbol

rs43006866 rs41255623 rs41616212 rs41623976 rs41566432 rs110539904 rs41579391 rs41701446 rs111010813 rs43425225 rs108986373 rs41611289 rs43442824 rs42260933 rs41622993 rs41597368 rs110932603 rs110608572 rs41624135 rs29026853 rs41615197 rs110205996 rs42256240 rs109605584 rs109152570 rs41651027 rs41628446 rs41680023 rs110267284 rs41571939 rs42022714 rs41578757 rs109893602 rs109405104 rs109024372 rs108956519 rs41572972 rs41604816 rs109438470 rs42982163 rs110202120 rs110602266 rs110459320 rs41633195 rs41627925 rs109230481 rs110697583 rs109209050 rs41584865 rs41617418 rs109876252 rs41640976 rs109057891

1 1 1 1 1 2 2 3 4 5 5 5 5 7 7 7 8 10 10 10 11 11 12 12 12 12 12 12 14 15 15 16 16 16 16 17 17 17 17 17 17 17 17 17 17 19 19 19 19 19 19 19 19

21693513 57752344 58985342 90714916 92461552 98217598 117151265 86180854 103231866 6528982 22053661 91494429 105449703 66550122 87556048 109970008 10140515 12870180 50462356 53560658 35897464 79852413 9925695 33576827 34635671 56055676 57684714 76896007 26003598 5400560 5825778 27164390 30186769 70754436 72114575 20892863 26418537 27826675 30676454 30925441 38467666 41066514 44822427 47700237 50429878 13720853 14008574 16779459 17118867 18384729 19587050 20293612 20974167

8.7E-05 1.2E-04 9.1E-05 4.4E-06 3.2E-06 6.2E-05 7.2E-05 5.6E-05 1.0E-04 1.0E-05 1.3E-05 7.1E-05 5.8E-05 6.2E-05 1.3E-04 2.2E-05 4.6E-05 1.0E-04 6.0E-05 5.8E-05 9.8E-05 8.3E-05 1.4E-04 1.0E-04 1.2E-04 7.9E-06 3.5E-05 3.7E-06 1.3E-04 2.9E-07 4.3E-05 3.5E-07 1.3E-04 1.3E-04 9.1E-06 1.4E-04 9.5E-09 9.3E-05 1.6E-06 1.4E-05 6.9E-06 2.3E-05 6.5E-05 3.0E-05 4.3E-05 2.6E-05 7.9E-06 6.9E-07 5.6E-07 1.1E-04 3.7E-06 1.3E-05 2.9E-05

NRIP1 ATG3* GRAMD1C* TBL1XR1 NAALADL2* UNC80* A7E352_BOVIN C1orf87 ATP6V0A4* E2F7 BTG1 PLCZ1 KCNA5 GRIA1 EDIL3 LOC523504* FBX016 MEGF11* FOXB1 TCF12 ASB3 OSR1 LOC786945 SHISA2 MIPEP* OR10P1 IL23A DZIP1* FAM110B DYNC2H1 * MMP13 DISP1* PARP1 SMYD2 RPS6KC1 PCDH18 PCDH10 INTU INTU C17H4orf45 GUCY1A3 RIMBP2* HSFY2 AATF* C19H17orf78 * ACCN1* ACCN1* ADAP2* KSR1 * NLK* PIPOX *

84!

! ARS-BFGL-NGS-81462 ARS-BFGL-NGS-3281 BTB-01316060 BTB-01315978 ARS-BFGL-NGS-42430 ARS-BFGL-NGS-4759 ARS-BFGL-NGS-112923 Hapmap58303-ss46526468 Hapmap49617-BTA-45355 Hapmap56957-ss46526454 ARS-BFGL-NGS-24479 UA-IFASA-6117 BTA-45655-no-rs BTA-50728-no-rs ARS-BFGL-NGS-107424 ARS-BFGL-NGS-79806 UA-IFASA-7925 Hapmap50827-BTA-94026 ARS-BFGL-NGS-20502 Hapmap48141-BTA-98457 VA ARS-BFGL-NGS-19301 Hapmap38391-BTA-18545 ARS-BFGL-NGS-97051 BTA-38242-no-rs ARS-BFGL-NGS-108496 BTB-01017247 9 DD ARS-BFGL-NGS-98565 Hapmap43748-BTA-103824 Hapmap56398-rs29010937 ARS-BFGL-NGS-62454 ARS-BFGL-NGS-42947 Hapmap47516-BTA-116004 ARS-BFGL-NGS-16913

!

rs41598054 rs110386214 rs42442741 rs42441962 rs109099212 rs109182853 rs41909659 rs41256931 rs41576388 rs41256918 rs41916457 rs41636123 rs41577559 rs41581533 rs111020323 rs109898853 rs41604928 rs41668379 rs108990458 rs41566027

19 19 19 19 19 19 19 19 19 19 19 19 19 20 21 23 24 24 25 27

24917540 25047166 30340650 30446351 31087581 35253851 35419429 37552530 38466576 42902904 45109206 46075773 46202442 48749320 63708710 16625327 679380 2166631 42097688 42751177

1.0E-04 1.9E-08 5.1E-07 8.9E-06 7.8E-05 4.1E-05 9.8E-07 1.1E-04 9.8E-04 9.5E-05 3.1E-05 4.3E-05 1.0E-04 4.0E-08 4.6E-08 1.4E-04 9.5E-05 4.9E-05 8.3E-05 1.2E-05

SHPK ITGAE* TMEM220 PIRT DNAH9* RAI1* PEMT* SLC35B1* HOXB9 RAB5C* ADAM11* WNT3 NSF* CDH10 VRK1 PPP2R5D* ADNP2 GALR1 MICALL2 UBE2E2

rs110847444 rs41575963 rs42357017 rs41578757 rs109178989 rs42176310

4 12 15 16 17 29

89017584 26810556 20500282 27164390 25441346 28809817

3.8E-06 1.0E-05 6.3E-06 2.8E-06 4.7E-06 4.8E-06

SPAM1 RFC3 ZC3H12C* DISP1* PCDH10 CCDC15*

rs109886869 rs41609745 rs29010937 rs41851087 rs42703571 rs41566730 rs109873278

5 7 14 17 28 28 28

116861955 65358446 13949095 66751217 2313753 2902778 8346709

1.2E-05 2.7E-06 8.7E-06 3.8E-06 7.1E-06 3.2E-06 4.0E-06

ATXN10* GLRA1 MYC ISCU RHOU OR4P4 GNG4*

85!

!

Table 4. SNPs located above PFP 5% threshold within 1 Mbp distance from genes encoding for enzymes with an important role in fat and fatty acid metabolism. Gene and SNPs location (near gene) as in the Bos_taurus_UMD_3.1 assembly; gene symbol as in GenBank. Illumina SNP name CLA ARS-BFGL-NGS-3990 ARS-BFGL-NGS-113196 ARS-BFGL-NGS-116497 BTB-01316060 BTB-01315978 ARS-BFGL-NGS-42430 ARS-BFGL-NGS-4759 ARS-BFGL-NGS-112923 Hapmap58303-ss46526468 Hapmap49617-BTA-45355 Hapmap56957-ss46526454 9 DD ARS-BFGL-NGS-62454 Hapmap47516-BTA-116004

!

Genbank SNP code

Bta

SNP position

P-value

Gene symbol

rs110539904 rs111010813 rs109230481 rs42442741 rs42441962 rs109099212 rs109182853 rs41909659 rs41256931 rs41576388 rs41256918

2 4 19 19 19 19 19 19 19 19 19

98217598 103231866 13720853 30340650 30446351 31087581 35253851 35419429 37552530 38466576 42902904

6.2E-05 1.1E-04 2.6E-05 5.1E-07 8.9E-06 7.8E-05 4.1E-05 9.8E-07 1.2E-04 1.1E-04 1.0E-04

ACADL DGK1 ACACA ADPRM ADPRM ADPRM PEMT/SREBF1 PEMT/SREBF1 PHOSPHO1 PHOSPHO1 STAT5A/ACLY

rs41851087 rs41566730

17 28

66751217 2902778

3.8E-06 3.3E-06

ACACB GNPAT

86!

!

Table 5. SNPs significant between 5 and 10% PFP threshold located within 1 Mbp from genes encoding for enzymes with an important role in fat and fatty acid metabolism. Gene and SNPs location (near gene) as in the Bos_taurus_UMD_3.1 assembly; gene symbol as in GenBank. Illumina SNP name CLA BTA-114831-no-rs ARS-BFGL-BAC-2813 ARS-BFGL-NGS-17824 ARS-BFGL-NGS-116551 ARS-BFGL-NGS-119102 ARS-BFGL-NGS-44706 Hapmap42977-BTA-55653 BTB-01631910 ARS-BFGL-NGS-100532 UA-IFASA-7338 ARS-BFGL-NGS-14867 ARS-BFGL-NGS-114182 ARS-BFGL-NGS-101807 ARS-BFGL-NGS-101953 ARS-BFGL-NGS-28121 ARS-BFGL-NGS-2725 UA-IFASA-6229 ARS-BFGL-NGS-35579 VA BTA-13765-no-rs ARS-BFGL-NGS-94026 9 DD ARS-BFGL-NGS-104914

!

Genbank SNP code

Bta

SNP position

P-value

Gene symbol

rs41574370 rs42208635 rs41664795 rs110675288 rs109324940 rs41781118 rs41640777 rs42743382 rs109873397 rs41636041 rs110036994 rs110697583 rs109477972 rs41913537 rs43729464 rs110970486 rs41626402 rs110035524

2 2 4 12 14 15 16 18 18 19 19 19 19 19 19 23 23 26

39709004 39086521 118169220 12446625 70003286 76438547 1784252 64045527 63878550 8200102 7940557 14008574 30413271 35191657 42227236 24904300 31485437 26058953

3.3E-04 3.0E-04 4.2E-04 9.8E-04 3.0E-04 4.8E-04 7.2E-04 1.0E-03 7.8E-04 1.7E-04 6.9E-04 3.0E-04 2.5E-04 5.6E-04 5.0E-04 7.4E-04 1.1E-03 6.9E-04

GPD2 GPD2 INSIG1 DGKH PTDSS1 DGKZ ETNK2 MBOAT7 PLA2G15 DGKE DGKE ACACA ADPRM PEMT/SREBF1 STAT5A ELOVL5 BTN1A1 ECHS1

rs29018723 rs111010211

15 27

56548395 37145353

3.1E-05 6.0E-05

MOGAT2/DGAT2 AGPAT6

rs109526874

5

119512385

1.7E-05

CPT1B/CHKB

87!

!

Table 6. SNPs significant between 10 and 20% PFP threshold located within 1 Mbp from genes encoding for enzymes with an important role in fat and fatty acid metabolism. Gene and SNPs location (near gene) as in the Bos_taurus_UMD_3.1 assembly; gene symbol as in GenBank. Genbank SNP code

Bta

SNP position

Pvalue

rs110857438 rs41629000 rs41591617 rs108938799 rs109311371 rs110528559 rs110294118 rs109546807 rs110183937 rs29023212 rs41615970 rs109444154 rs41568613 rs109815065 rs109522117 rs43621939 rs43626465 rs41654582 rs110826199 rs110842319 rs110103846 rs41616215 rs109927983 rs29012667 rs111008377 rs109661298 rs109758686 rs41664749 s109438582 rs41632633 rs29027509 rs41565443 rs110655056 rs41574731 rs109873397 rs109284305 rs110960592 rs42882121 rs110660541 rs109678934 rs41644849 rs110497942 rs110510166 rs109036118 rs41569897 rs109581848 rs41574666 rs42099589 rs110039409 rs42116262

1 2 4 4 4 4 4 5 5 5 5 5 7 7 8 10 10 10 10 10 11 11 11 12 13 14 14 15 15 15 16 16 18 18 18 18 19 19 19 19 19 19 19 19 19 19 23 26 26 27

97420045 128889674 22706540 23543662 98486908 101758469 117100753 65986618 65228699 88978964 88659509 119235517 13526016 17913294 25958375 28680745 52558914 85547284 86126108 86155673 2603799 48179532 69884769 12041734 65817864 2319504 45945108 18924675 28646485 78966608 68785131 69795545 27281676 23559322 63878550 64231273 28545943 28342107 30783257 37670702 37817322 37994541 38059659 43295532 43804606 51299813 49260004 32821171 42807171 14615571

Hapmap61072-rs29024053 ARS-BFGL-NGS-87919

rs29024053 rs109197682

4 8

23915993 63383924

1.7E-03 3.9E-03 4.9E-03 3.8E-03 1.8E-03 3.5E-03 1.5E-03 2.1E-03 4.0E-03 6.5E-03 3.6E-03 1.7E-03 6.0E-03 4.1E-03 2.6E-03 6.2E-03 2.3E-03 5.4E-03 5.0E-03 2.5E-03 5.9E-03 6.6E-03 3.5E-03 1.5E-03 3.8E-03 5.9E-03 3.2E-03 5.0E-03 2.4E-03 5.0E-03 1.7E-03 6.0E-03 5.2E-03 4.2E-03 1.7E-03 3.6E-03 4.1E-03 1.3E-03 5.4E-03 2.0E-03 2.7E-03 4.4E-03 4.7E-03 4.6E-03 5.4E-03 4.2E-03 4.1E-03 3.9E-03 5.9E-03 4.2E-03 1.0E+0 0 3.3E-04 5.9E-04

Hapmap57042-rs29016514

rs29016514

17

64950742

2.2E-04

Illumina SNP name CLA ARS-BFGL-NGS-19572 BTA-31262-no-rs BTA-72579-no-rs Hapmap27013-BTA-158242 ARS-BFGL-NGS-112658 ARS-BFGL-NGS-7597 ARS-BFGL-NGS-30174 ARS-BFGL-NGS-15520 ARS-BFGL-NGS-24122 Hapmap59389-rs29023212 BTA-107103-no-rs ARS-BFGL-NGS-115195 Hapmap48480-BTA-80747 ARS-BFGL-NGS-70183 ARS-BFGL-NGS-52642 BTB-00415258 BTB-00424771 Hapmap41972-BTA-79298 ARS-BFGL-NGS-116336 ARS-BFGL-NGS-108846 ARS-BFGL-NGS-113057 Hapmap38795-BTA-97039 ARS-BFGL-NGS-22048 Hapmap53580-rs29012667 ARS-BFGL-NGS-114368 ARS-BFGL-NGS-101653 ARS-BFGL-NGS-108612 Hapmap44329-BTA-98197 ARS-BFGL-NGS-118149 Hapmap42192-BTA-37799 Hapmap52389-rs29027509 Hapmap46938-BTA-114095 Hapmap23161-BTA-162019 Hapmap38205-BTA-17257 ARS-BFGL-NGS-100532 ARS-BFGL-NGS-113896 ARS-BFGL-NGS-31543 ARS-BFGL-NGS-119468 ARS-BFGL-NGS-31404 ARS-BFGL-NGS-105181 BTA-45324-no-rs ARS-BFGL-NGS-112209 ARS-BFGL-NGS-39738 ARS-BFGL-NGS-22409 BTA-108326-no-rs ARS-BFGL-NGS-109613 Hapmap49546-BTA-25249 BTB-00938770 ARS-BFGL-NGS-62648 ARS-BFGL-NGS-72832 VA

!

Gene symbol PLD1 LYPLA2 DGK4 DGK4 DGKI DGKI INSIG1 CHPT1 CHPT1 ETNK1 ETNK2 CHKB/CPT1B GCDH PNPLA6 PLIN2 LPCAT4 LIPC ACOT4/ACOT2 ACOT4/ACOT2 ACOT4/ACOT2 GPAT2 FABP1 LPCAT1 DGKH ACSS2 DGAT1 FABP5 ACAT1 APOA1 NR1H3 PLA2G4A PLA2G4A GOT2 LPCAT2 PLA2G15 MBOAT7 ACADVL ACADVL ADPRM PHOSPHO1 PHOSPHO1 PHOSPHO1 PHOSPHO1 STAT5A STAT5A FASN/PCYT2 ECI2 GPAM /ACSL5 ACADSB ACSL1

DGK4 ALDH1B1 PLA2G1B/ ALDH2

88!

!

!

BTB-00750203 ARS-BFGL-NGS-35579 9 DD BTA-85566-no-rs BTB-01858480 ARS-BFGL-NGS-99043 ARB-BFGL-NGS-50023 ARS-BFGL-NGS-119102

rs41911936 rs110035524

19 26

38268968 26058953

4.2E-04 1.4E-04

PHOSPHO1 ECHS1

rs43743037 rs42971522 rs110908109 rs109324940

5 5 13 14 14

66040455 88249394 71301458 18597213 70003286

1.4E-03 1.7E-03 3.6E-04 8.1E-04 6.5E-05

Hapmap57042-rs29016514

rs29016514

17

64950742

8.9E-05

ARS-BFGL-BAC-36625

rs110325149

17

64982245

7.8E-04

ARS-BFGL-NGS-112123 ARS-BFGL-NGS-102695 ARS-BFGL-NGS-112916 ARS-BFGL-NGS-46832 ARS-BFGL-NGS-721 BTA-91041-no-rs BTA-116005-no-rs Hapmap49856-BTA-108815

rs41852678 rs41852077 rs109578063 rs41921756 rs109731156 rs41659095 rs41613328 rs41615922

17 17 19 19 23 26 28 28

65771136 66790999 26398385 55721945 49061686 32792279 2869287 3998395

1.0E-03 4.0E-04 5.9E-04 1.4E-03 9.8E-04 9.8E-04 5.6E-04 6.9E-04

CHPT1 ETNK1 LIPIN3 ACAT1 PTDSS1 ALDH2/ PLA2G1B ALDH2/ PLA2G1B ACACB ACACB PLD2/ACADVL ACOX1 ECI2 GPAM/ASCL5 GNPAT GNPAT

89!

!

Figure 1. Role of rumen biohydrogenation and tissue D9D in the production of cis-9 trans11 conjugated linoleic acid in milk fat and in different tissues. Adapted from Bauman & Lock (2006).

!

90!

!

Figure 2. Quantile-quantile plots of the observed distribution of the p-value at marker level for CLA, VA and D9D

Figure 3. Quantile-quantile plots of SNPs at marker level for CLA, VA and D9D comparing the association statistics expected under the null hypothesis of no association.

Figure 4. The location of SNPs associated with CLA VA and D9D shown as a Manhattan plot. Odd-numbered chromosomes are shown in orange; even-numbered chromosomes are shown in black. The horizontal blue and dashed line represent the 5% proportion of false positives (PFP) threshold; the horizontal red and dotted line represent the 10% PFP threshold and the horizontal green and solid line represent the 20% PFP threshold.

!

91!

!

Figure 5. Association regions for CLA in all chromosomes

Figure 6. Association regions for VA in all chromosomes

Figure 7. Association regions for D9D in all chromosomes

!

92!

!

Figure 8. Metabolic lipid pathways in which genes are involved according to KEGG database

!

93!

!

CHAPTER 3

GENOME-WIDE

ASSOCIATION

STUDY

FOR

SOMATIC

CELL

SCORE

IN

VALDOSTANA RED PIED CATTLE BREED USING POOLED DNA

Maria G. Strillacci*, Erika Frigo*, Fausta Schiavini*#, Antonia B. Samoré*, Fabiola Canavesi*, Mario Vevey§, Maria C. Cozzi*, Morris Soller†, Ehud Lipkin†, Alessandro Bagnato*#

*Department of Health, Animal Science and Food Safety (VESPA), University of Milan, Via Celoria 10, 20133, Milan, Italy. #Genomic and Bioinformatics Platform, University of Milan, c/o Fondazione Filarete, Viale Ortles 20, 20100 Milano, Italy †Department of Genetics. The Hebrew University of Jerusalem, 91904 Jerusalem, Israel §Associazione Nazionale Allevatori Bovini di Razza Valdostana (A.N.A.Bo.Ra.Va.), Fraz. Favret, 5 11020 Gressan (AO), Italy

Published in BMC Genetics, 15:106 doi:10.1186/s12863-014-0106-7

!

94!

!

3.1. ABSTRACT Background: Mastitis is a major disease of dairy cattle occurring in response to environmental exposure to infective agents with a great economic impact on dairy industry. Somatic cell count (SCC) and its log transformation in somatic cell score (SCS) are traits that have been used as indirect measures of resistance to mastitis for decades in selective breeding. A selective DNA pooling (SDP) approach was applied to identify Quantitative Trait Loci (QTL) for SCS in Valdostana Red Pied cattle using the Illumina Bovine HD BeadChip. Results: A total of 171 SNPs reached the genome-wide significance for association with SCS. Fifty-two SNPs were annotated within genes, some of those involved in the immune response to mastitis. On BTAs 1, 2, 3, 4, 9, 13, 15, 17, 21 and 22 the largest number of markers in association to the trait was found. These regions identified novel genomic regions related to mastitis (1-Mb SNP windows) and confirmed those already mapped. The largest number of significant SNPs exceeding the threshold for genome-wide significant signal was found on BTA 15, located at 50.43-51.63 Mb. Conclusions:

The genomic regions identified in this study contribute to a better

understanding of the genetic control of the mastitis immune response in cattle and may allow the inclusion of more detailed QTL information in selection programs. 3.2. BACKGROUND Mastitis is one of the most frequent inflammatory disease with a significant economic implication for the dairy herds and the resistance to this pathology may be improved by breeding. The development of mastitis is the result of the interaction among three components: the individual genotype, the pathogens (ordinarily classified in contagious and environmental bacteria) and the environment (hygiene, housing, climate, milking machines, feeding) [1]. The resistance to an infection disease or the absence of susceptibility may be defined as the immune response ability (immuno-competence capability) of an animal, to avoid the pathogens replication after the establishment of an infection. This implies that animals tend to vary in their genetic potential for immuno-competence [2]. The genetic resistance or the genetic susceptibility to mastitis involves interlinked biological mechanisms that activate and regulate the different levels of the immune response, as a consequence of the differences existing in the response to mastitis involving several pathogens [3]. A better understanding of the immune system and of the metabolic pathways involved in the response to various pathogens of resistant and susceptible animals may be used as !

95!

!

complementary approach for the disease control. The discovery of millions of SNP markers in animal genomes forming dense marker panels, and the concomitant decrease in genotyping costs have allowed the performing of genome-wide association studies (GWAS) [4]. The availability of SNP dense genotypes have increased the power of the identification of QTL related to the traits of interest [5], allowing more accurate breeding values estimation with the use of genomic selection methodology and helping the understanding of the genetic control of the traits of interest [6]. Because of the established knowledge of the positive genetic correlation between clinical mastitis and SCS ranging from 0.6 to 0.8 [1], SCC is one of the traits used as an indirect measure of mastitis resistance/susceptibility in breeding programs in cattle and sheep. Many GWAS have detected QTL for SCC in cattle on BTAs 5, 6, 8, 11, 17, 18, 20 and 23 in cosmopolite improved dairy cattle breeds [1-7]. The high costs of screening large populations for marker allele frequencies can be decreased using the SDP approach, genotyping pooled DNA samples from selected individuals at each of the two phenotypic extremes of the trait distribution [8]. Equal amounts of DNA are pooled from individuals in the extreme tails, and pools are then genotyped to estimate allele frequency differences for each SNP among high and low tail pools. The significant identified candidate SNPs are then used for confirmatory association studies [9]. The aim of this study was to identify QTL associated with SCS as an indicator of mastitis. We performed a GWA study for SCS in the Valdostana Red Pied cattle, with a selective DNA pooling analysis, using the Illumina BovineHD Bead chip.

3.3. RESULTS AND DISCUSSION Among the 2,417 bulls with DP-EBV values, 275 had semen samples available in the Valdostana Red Pied bio-bank that encompassed in total 373 sires samples spanning across generations. The Valdostana Red Pied population counting at present about 11,000 milking cows did not undergo focussed selection for milk production only and no gene introgression from other populations have ever occurred. The breed is strongly adapted to harsh alpine environment because breed natural adaptation and because has been selected to maintain pasture capability (summer pasture is the common farming system), longevity, functionality and fertility. Thus, the population is somehow a unique genetic resource to map mastitis resistance, a trait related to adaptation, functionality and longevity. The study !

96!

!

used all the sire samples available in the Valdostana Red Pied bio-bank thus highlighting the overall observable variability for productive and functional traits in this breed. The smaller number of sire available for the study respect to mapping in cosmopolitan population, may limit the capacity to disclose QTL for mastitis resistance. Nevertheless the experimental design here used and the genetic makeup of the population allowed to identify several new QTL and confirm regions identified in the Italian and Swiss Brown population [10], another breed originating from alpine region, now strongly selected for milk production. Descriptive statistics for the DP-EBVs and the size of the pools for each tail are reported in Table 1. The initial dataset included 721,644 SNPs. After editing, the association analysis were performed with 655,665 SNPs for SCS DP-EBV. Figure 1 shows the Q-Q plot of SNPs at marker level (p-values). Deviations from the identity line showed the amount of false positive tests resulted from the analysis of the data. Figure 2 showed the Manhattan plot of genome-wide associations for SCS trait. A total of 171 significant SNPs in 24 chromosomes were identified above the Bonferroni genome-wide threshold of 0.05. The Additional file 1 showed the list of the 171 significant SNPs identified. The SNPs location and the gene annotation were reported for both the UMD3.1 and Btau4.6.1 assembly. Table in Additional file 1 included the indication of QTL, amongst

the

ones

here

disclosed,

reported

in

the

online

AnimalQTLdb

(http://www.animalgenome.org/cgi-bin/QTLdb/index) for clinical mastitis, SCC and SCS. Intragenic SNPs Among the 171 significant markers, 52 SNPs were annotated within 36 genes (Table 2). In Table 2 the significant intragenic SNPs and their corresponding annotated genes in the Btau 4.6.1 assembly are reported. The BovineHD0900019961 (rs136413030) SNP was associated to the VNN1 (vanin 1) on BTA9, the BovineHD1500008135 (rs134980659) SNP was associated to the THY1 (Thy-1 cell surface antigen) located on BTA 15 and the BovineHD2100001405 (rs133992914) SNP was associated to the IGF1R (insulin-like growth factor 1 receptor), located on BTA 21. Also

the

BovineHD1500008366

(rs41754552)

and

the

BovineHD1500008367

(rs110269361) SNPs were located respectively at 594,104bp and 601,630bp from THY1 on BTA15. THY1 is one of the genes differentially expressed between control quarters from cows infected with E. coli and S. aureus pathogens [11]. Also Moyes et al., 2009 [12] reported !

97!

!

the THY1 upregulation in S. uberis intramammary infections. Sugimoto and Sugimoto, 2012 [13] provided evidence that the IGF1R is involved in innate immunity through autophagy (general term for the degradation of cytoplasmic components within lysosomes, [14]) in bovine. In Bos taurus, in fact a polymorphism in the 5’UTR region of IGF1R (BTA 21) was associated to mastitis incidence, determining the inhibition of autophagy in response to S. Agalactiae invasion. Nearby Genes SNPs The BovineHD0900019716 (rs109049649), the BovineHD4100007550 (rs41662465) and the Hapmap49339-BTA-84110 (rs41662464) SNPs were mapped near the VNN1 (vanin 1) and the VNN2 (vanin 2) located on BTA 9 respectively at 73.37Mb and 73.39Mb. On the same BTA 9, the BovineHD0900019961 (rs136413030) SNP were close to VNN2. Jiang et al., 2012 [15] reported that VNN1 and VNN2 are related to resistance to bovine mastitis, being ranked among the 160 most mastitis relevant genes. On BTA 19, at 55 Mb, SOCS3 (suppressor of cytokine signalling 3) was found at 673,863 bp upstream the BovineHD1900015066 (rs132720248) SNP. This gene, important for the mammary tissue homeostasis, encodes an intracellular inhibitor of cytokine signaling, thus playing an important role in the initial steps of the recognition of pathogen-associated molecular pattern (PAMP) of the innate immune cells. This leads to the activation and initiation of the innate and the adaptive immune responses. Heeg and Dalpke, 2003 [16] and Brenaut et al., 2014 [17] found the SOCS3 gene among the 39 differentially expressed genes in milk fat globules of goats in response to an experimental intramammary infection with S. aureus. The gene encoding for the serine dehydratase (SDS) on BTA17 was located 416,619 bp upstream of the BovineHD1700018352 (rs135157738) SNP. This gene is included in the glycine, serine and threonine metabolism, as reported by [18]. These authors demonstrated that the serine dehydratase is one of the enzymes that changed significantly in bovine affected to mastitis. Four SNPs on BTA9 (BovineHD0900019961 (rs136413030), BovineHD0900019716 (rs109049649), BovineHD4100007550 (rs41662465) and Hapmap49339-BTA-84110 (rs41662464)) mapped near CTGF (connective tissue growth factor). The ZNFX1 (X1type zinc finger-containing) on BTA13 was close to four SNPs (BovineHD4100010442 (rs41634068),

BovineHD1300022626

(rs137320993),

BovineHD1300022630

(rs109123247) and BovineHD1300022672 (rs41710487)). The TRIM21 (tripartite motif containing 21) was located 444,354 Mb upstream the strongest association chromosome region identified in BTA 15 (Table 3). The CXCL2 (Chemokine (C-X-C motif) ligand 2) and !

98!

!

the CXCL10 (Chemokine (C-X-C motif) ligand 10) on BTA6 were significantly associated to the BovineHD0600025253 (rs42615160) SNP. The genes above mentioned near to significant SNPs ( ZNFX1, CTGF, TRIM21, CXCL2 and CXCL10) are significantly differentially expressed by the bovine mammary epithelial cells stimulated with E. coli crude lipopolysaccharide [19]. Jensen et al., 2013 [10] studied and compared the transcriptional responses of uninfected mammary gland quarters adjacent to quarters infected with E. coli and S. aureus in Holstein cows. The CXCL2 resulted to be one of the genes differentially expressed between control quarters infected with both the pathogens, while the CXCL10 resulted to be one of the genes differentially expressed in control quarters from animals infected with S. aureus for 24 and 72 hours. The BovineHD2200003506 (rs110821186) SNP on BTA 22 mapped close to the MYD88 (myeloid differentiation primary-response gene 88) at 11.72Mb which plays a functional role in transducing pro-inflammatory molecule lipopolysaccharide (LPS) that are responsible for the majority of acute clinical cases of mastitis [20]. Chromosome regions associated to SCS and clinical mastitis Table 3 reported a list of the chromosome regions defined by at least three SNPs that were strongly associated to SCS. The highest number of significant SNPs (14) exceeding the significant threshold for genome-wide significance signal was found on BTA 15 (located at 50.43-51.63 Mb). On the same BTA15, also two smaller peaks consisting of three SNPs located at 28.39-28.99 and 5 SNPs located at 31.28-32.02 Mb were identified. These regions are located in QTL that were mapped, respectively, for clinical mastitis using a linkage analysis [21] and for SCS [22]. The region located at 50.43-51.63 Mb on BTA15 has not been reported before in cattle breeds (http://www.animalgenome.org/cgibin/QTLdb/index), thus identifying a supposed candidate chromosome region associated to SCS. The chromosome region on BTA9 (72.78-72.80 Mb) mapped in a QTL region previously identified for the general disease resistance (including clinical mastitis) and for SCS [23] Lund et al., 2008 [21] found a QTL region associated to SCS located at 32.62-43.31 Mb on BTA 22. In our study, three significant SNPs were in this region. Sahana et al., 2013 [24] in a study on the confirmation and fine-mapping of clinical mastitis and SCS QTL in Nordic Holstein cattle using BovineSNP50 BeadChip found the highest number of significant associations on BTA6 identifying a QTL region for clinical mastitis at 83.37-88.89 Mb (UMD3.1 assembly). This result was also confirmed in a recent study in German Holstein cattle [25]. In our study, two significant SNPs (BovineHD0600023179 !

99!

!

(rs133319155) and BovineHD0600023185 (rs136907262)) were found respectively at 84.25 and 84.26 Mb on BTA6 (UMD3.1 assembly; Btau4.6.1 assembly position was not available), being mapped within the QTL region described by the authors previously cited (see Additional file 1). Annotation Among the 36 genes listed in Table 2, the annotation data were available for 23 genes reported in the Additional file 2. This lists the biological processes (BP), the cellular components (CC), the molecular function (MF) and the metabolic pathways (KEGG) obtained with the annotation analyses performed with DAVID online Database. The literature brings evidence that some of the genes reported in Table 2 map in QTL associated to traits of economic importance in bovine (http://www.animalgenome.org/cgibin/QTLdb/BT/index) as showed in Additional file 3. Those mapping in QTL already associated to clinical mastitis and SCS reported in the QTLdb were only 4: the PLXNA4 (plexin A4) on BTA4, the THY1 (Thy-1 cell surface antigen) on BTA15 and the SHISA9 (known as CKAMP44, shisa homolog 9) on BTA 25, the FAM19A1 (family with sequence similarity 19 (chemokine (C-C motif)-like), member A1) on BTA22 associated with SCS. This study thus highlighted possible QTL related to mastitis resistance in the other 19 genes annotated and considered in the GO analysis.

3.4. CONCLUSIONS This is the first mapping for SCS in Valdostana Red Pied population, an autochthonous alpine dual purpose cattle breed whose selection is mainly focused on milk quality, meat production and functionality. This study brings evidence of significant associations between SCS and SNP markers on several chromosomes in known and newly disclosed QTL regions. Some genes involved in mastitis resistance or variation of SCS content were in QTL on BTAs 9, 13, 15, 17, 19, 21, 22. In particular, the strongest associations were highlighted on BTA 15 with a total of 24 significant SNPs distributed in three regions. The detection of genomic regions will help to understand which potential candidate genes may be responsible for the genetic variation in mastitis resistance/susceptibility, a trait of primary importance in dairy cattle breeding and farming.

!

100!

!

3.5. METHODS Sampling The Valdostana Red Pied cattle is the most common autochthonous dual purpose breed in the region Val d’Aosta (13,000 animals in 2013, almost all of them registered in the Herd Book), coming from the red pied cattle and dating back to the end of the fifth century. The National Association of Valdostana Breeders (A.N.A.Bo.Ra.Va.) provided semen samples for 373 bulls and 725,337 test day records from milk routine recording from 45,410 cows. The daily SCC were transformed into SCS [26]. Genetic parameters and estimated breeding values (EBVs) were calculated with a test day repeatability model on first parity cows. The model of analysis considered the fixed effects of days in milk (10 classes of 30 days each), herd-test day effect (32,870 levels), month of calving and age at calving (12 classes). Additive genetic and permanent environmental effects were considered as random. Three generations of ancestors were used for each individual extracting information from the National Herd Book for a total of 35,803 animals. Variance component estimations were calculated based on 258,680 test day records with the software VCE [27] and individual EBVs were obtained with the package BLUPF90 [28]. Deregressed proofs (DP-EBV) were calculated for 2,417 bulls according to [29]. Pool constitution The bull families structure was verified in terms of number of sons per bull, in order to avoid overrepresentation of a single sire. Only 1 bull had 6 sons, 4 bulls had 5 sons, 3 bulls had 4 sons and the rest of bulls had 3 or less sons. The sires were ranked according to DP-EBVs for SCS: the top 20% and bottom 20% sires were identified for the constitution of independent pools within tail of the DP-EBV distribution.

In order to obtain two

independent groups of different animals within tail with comparable phenotypic value, the selected samples for each tail were clustered (even and odds numbers) into 2 sub-pools. A total of 79 samples were selected for the pools constitution as follows: 2 independent pools of 20 individuals each in the high tail and 2 independent pools of 20 and 19 individuals each in the low tail. Furthermore, for each pool, 2 DNA duplicate-pools were independently constructed from identical samples. Thus, a total of 4 pools per tail were produced. DNA extraction and genotyping Bulls DNA was extracted from semen samples using the ZR Genomic DNA TM Tissue MiniPrep (Zymo). The quality control was performed on each sample to verify the DNA integrity on Invitrogen E-Gel 1% Agarose Gel. The GloMax®-Multi Detection System instrument using the Quant-iT™ dsDNA Broad-Range (BR) Assay Kit (Life Technologies), !

101!

!

determined the initial DNA concentrations. The DNA concentration for a single sample was evaluated three times and each read was verified twice (e.g. 2 instrument runs). Samples having concentration diverging ±1 SD from the mean value were not included in the pools. Samples of DNA were normalized to a concentration of 10 ng/ul which was reconfirmed with the same methods above described. DNA pools were constructed by taking equivalent amounts of DNA from each sample. The final pools were concentrated to 50 ng/ul, as required for the Illumina array protocol. Each sub-pool was genotyped 3 times on different chips (array replicates). In all, 24 different chip positions on 3 microarrays were used for the pooled genotyping. Genotyping was performed using the Illumina BovineHD BeadChip (777,962 SNPs) according to the Infinium protocol. SNPs positions were accordingly to the UMB 3.1 bovine assembly. Statistical analysis of pools Pools were analysed according to the SDP approach. The B-allele frequencies being a good estimator of the allele frequency of the individuals in a pool for each array replicate [30], were used in the analyses after obtaining them from the self-normalization algorithm of Illumina BeadStudio software®. The multiple marker test A pipeline in R software (http://www.r-project.org/) was adapted from [31] and [32] to perform a multiple marker test. The test statistic used for each SNP was: Ztest=Dtest/SD(Dnull) where Dtest is the difference of the B-allele frequencies means among tails; Dnull is the difference of the B-allele frequencies means within tails. The test statistic was distributed as c2 with one degree of freedom under the null hypothesis of equal allele frequencies. Quality control We performed the analysis after excluding the 1% of SNPs that showed the highest variability as indicated by the size of the mean measures from the replicate array within tail [9]. In addition, the monomorphic SNPs were deleted from the dataset. Anderson-Darling, Shapiro-Wilk and Kolmogorov-Smirnov normality tests were performed on the Dnull distribution [33-34-35] The distribution of the p-values using the quantile-quantile (Q-Q) plot was examined to estimate the number and the magnitude of the observed associations between genotyped

!

102!

!

SNPs and DP-EBVs, compared to the statistics expected under the null hypothesis of no association. Using the -log10 of the linkage test p-values for each SNP, a Manhattan plot was created. Manhattan plot is a SNP set out across the chromosomes for left to the right, and the heights correspond to the strength of the associations of the trait. Bonferroni correction for multiple testing was applied in the analysis. The genome-wide significance threshold was set as a corrected p-value ≤ 0.05, which equated to a nominal p-value of approximately 7.62 x 10-8. Annotation The annotation analysis of significant SNPs was performed using UCSC, NCBI ENSEMBL and

the

Bovine

SNP

Annotation

Tool

(Snat)

(http://animalgenetics.cau.edu.cn/snat/dbSNP.html), integrating the information from a variety of public bioinformatics databases (NCBI Entrez Gene, UniProt, Gene Ontology (GO), KEGG PATHWAY and AnimalQTLdb [36]). The Illumina BovineHD SNPs positions were converted from Bos_taurus_UMD_3.1 to Btau_4.6.1 assembly using the Batch Coordinate Conversion option in UCSC database as required by Snat tools. UCSC and NCBI databases were used to annotate those SNPs not included in Snat and to verify which of the significant SNPs were close (within 1 Mb [31], [37]) to functional genes. GO and pathway analyses were performed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.7. Acknowledgments: This study was funded by EC-FP7/2007-2013, agreement n°222664, “Quantomics”. Authors gratefully acknowledge A.N.A.Bo.Ra.Va. for the availability of semen

!

samples

and

phenotypes

103!

!

3.6 REFERENCES 1. Sender G, Korwin-Kossakowska A, Pawlik A, Galal Abdel Hameed K, Oprządek J: Genetic basis of mastitis resistance in dairy cattle – a review. Ann Anim Sci 2013, 13:663673. 2. Knap PW, Bishop SC: Relationships between genetic change and infectious disease in domestic livestock. Br Soc Anim Sci 2000, 65-80. 3. Schukken YH, Günther J, Fitzpatrick J, Fontaine MC, Goetze L, Holst O, Leigh J, Petzl W, Schuberth HJ, Sipka A, Smith DG, Quesnell R, Watts J, Yancey R, Zerbe H, Gurjar A, Zadoks RN, Seyfert HM, members of the Pfizer mastitis research consortium: Hostresponse patterns of intramammary infections in dairy cows. Vet Immunol Immunopathol 2011, 144(3-4):270-89. 4. Hayes BJ, Bowman PJ, Chamberlain AJ, Goddard ME: Invited review: Genomic selection in dairy cattle: progress and challenges. J Dairy Sci 2009, 92(2):433-443. 5. Meuwissen TH, Solberg TR, Shepherd R, Woolliams J: A fast algorithm for BayesB type of prediction of genome-wide estimates of genetic value. Genet Sel Evol 2009, 5:41-42. 6. Pryce JE, Bolormaa S, Chamberlain AJ, Bowman PJ, Savin K, Goddard ME, Hayes BJ: A validated genome-wide association study in 2 dairy cattle breeds for milk production and fertility traits using variable length haplotypes. J Dairy Sci 2010, 93(7):3331-3345. 7. Meredith B, Lynn D, Berry D, Kearney F, Bradkey D, Finlay E, Fahey A: A genome-wide association study for somatic cell score using the illumine high density bovine beadchip identifies several novel QTL potentially related to mastitis susceptibility. Front Genet 2013, 4:229. 8. Darvasi A, Soller M: Selective DNA pooling for determination of linkage between a molecular marker and a quantitative trait locus. Genetics 1994, 138:1365-1373. 9. Janicki PK, Vealey R, Liu J, Escajeda J, Postula M, Welker K: Genome-wide association study using pooled DNA to identify candidate markers mediating susceptibility to postoperative nausea and vomiting. Anesthesiology 2011, 115(1):54-64. 10. Bagnato A, Soller M, Lipkin E, Samoré AB, Velayutham D, Schiavini F, Rossoni A, Dolezal MA: Genome Wide Association Analysis in Italian Brown Swiss for Somatic Cell Count [abstract]. Program and Book of Abstract 4th International Conference on Quantitative Genetics: Understanding Variation in Complex Trait 2012, 234-235. 11. Jensen K, Günther J, Talbot R, Petzl W, Zerbe H, Schuberth HJ, Seyfert HM, Glass EJ: Escherichia coli- and Staphylococcus aureus-induced mastitis differentially modulate transcriptional responses in neighbouring uninfected bovine mammary gland quarters. BMC Genomics 2013, 16:14-36. 12. Moyes KM, Drackley JK, Morin DE, Loor JJ: Greater expression of TLR2, TLR4, and IL6 due to negative energy balance is associated with lower expression of HLA-DRA and HLA!

104!

!

A in bovine blood neutrophils after intramammary mastitis challenge with Streptococcus uberis. Funct Integr Genomics 2010, 10(1):53-61. 13. Sugimoto M, Sugimoto Y: Variant in the 5' untranslated region of insulin-like growth factor 1 receptor is associated with susceptibility to mastitis in cattle. G3 (Bethesda) 2012, 2(9):1077-1084. 14. Mizushima N: Autophagy: process and function. Genes Dev 2007, 21(22):2861-2873. 15. Jiang L, Sørensen P, Thomsen B, Edwards SM, Skarman A, Røntved CM, Lund MS, Workman CT: Gene prioritization for livestock diseases by data integration. Physiol Genomics 2012, 44(5): 305-317. 16. Heeg, K, Dalpke A: TLR-induced negative regulatory circuits: role of suppressor of cytokine signaling (SOCS) proteins in innate immunity. Vaccine 2003, 21(Suppl 2): S61-67. 17. Brenaut P, Lefèvre L, Rau A, Laloë D, Pisoni G, Moroni P, Bevilacqua C, Martin P: Contribution of mammary epithelial cells to the immune response during early stages of a bacterial infection to Staphylococcus aureus. Vet Res 2014, 45:16. 18. Wang C, Wang J, Ju Z, Zhai R, Zhou L, Li Q, Li J, Li R, Huang J, Zhong J: Reconstruction of metabolic network in the bovine mammary gland tissue. Mol Biol Rep 2012, 39(7):73117318. 19. Gilbert FB, Cunha P, Jensen K, Glass EJ, Foucras G, Robert-Granié C, Rupp R, Rainard P: Differential response of bovine mammary epithelial cells to Staphylococcus aureus or Escherichia coli agonists of the innate immune system. Vet Res 2013, 44:40. 20. Cates EA, Connor EE, Mosser DM, Bannerman DD: Functional characterization of bovine TIRAP and MyD88 in mediating bacterial lipopolysaccharide-induced endothelial NFkappaB activation and apoptosis. Comp Immunol Microbiol Infect Dis 2009, 32(6):477-490. 21. Lund MS, Guldbrandtsen B, Buitenhuis AJ, Thomsen B, Bendixen C: Detection of quantitative trait loci in Danish Holstein cattle affecting clinical mastitis, somatic cell score, udder conformation traits, and assessment of associated effects on milk yield. J. Dairy Sci 2008, 91:4028–4036. 22. Rupp R, Boichard D: Genetics of resistance to mastitis in dairy cattle. Vet. Res 2003, 34:671–688. 23. Holmberg M, Andersson-Eklund L: Quantitative Trait Loci Affecting Health Traits in Swedish Dairy Cattle. J Dairy Sci 2004, 87:2653–2659. 24. Sahana G, Guldbrandtsen B, Thomsen B, Lund MS: Confirmation and fine-mapping of clinical mastitis and somatic cell score QTL in Nordic Holstein cattle. Anim Genet 2013, 44(6):620-626. 25. Abdel-Shafy H, Bortfeldt RH, Reissmann M, Brockmann GA: Short communication: Validation of somatic cell score-associated loci identified in a genome-wide association study in German Holstein cattle. J Dairy Sci 2014, 97(4):2481-2486. !

105!

! 26. Wiggans GR, Shook GE: A lactation measure of somatic cell count. J Dairy Sci 1987,

70(12):2666-2672. 27. Gilmour AR, Gogel BJ, Cullis BR, Thompson R: ASReml User Guide Release 3.0. VSN Int. Ltd. Hemel Hempstead. UK 2009. 28. Mistzal I, Tsuruta S, Strabel T, Auvray B, Druet T, Lee D: BLUPF90 and related programs (BGF90). [http://nce.ads.uga.edu/wiki/lib/exe/fetch.php?media=28-07.pdf]. 29. VanRaden PM, Wiggans GR: Derivation, calculation, and use of national animal model information. J Dairy Sci 1991, 74(8):2737-2746. 30. Janicki PK, Liu J: Accuracy of allele frequency estimates in pool DNA analyzed by highdensity Illumina Human 610-Quad microarray. The Internet Journal of Genomics and Proteomics 2009, 5:1. 31. Strillacci MG, Frigo E, Canavesi F, Ungar Y, Schiavini F, Zaniboni L, Reghenzani L, Cozzi MC, Samoré AB, Kashi Y, Shimoni E, Tal-Stein R, Soller M, Lipkin E, Bagnato A: QTL mapping for conjugated linoleic acid, vaccenic acid and Δ9-desaturase in Italian Brown Swiss dairy cattle using selective DNA pooling. Anim Gen, in press. 32. Bagnato A, Schiavini F, Rossoni A, Maltecca C, Dolezal M, Medugorac I, Sölkner J, Russo V, Fontanesi L, Friedmann A, Soller M, Lipkin E: Quantitative trait loci affecting milk yield and protein percent in a three-country Brown Swiss population. J Dairy Sci 2008, 91: 767– 783. 33. Stephens MA: Tests based on EDF statistics. In Goodness-of-Fit Techniques. Edited by Marcel Dekker New York; 1986:97-193. 34. Royston P: A remark on Algorithm AS 181: The W test for normality. In Applied Statistics. Edited by Wiley for the Royal Statistical Society; 1995, 44:547–551. 35. Marsaglia G, Tsang WW, Jingbo W: Evaluating Kolmogorov's distribution. Journal of Statistical Software 2003, 8:1-4. 36. Jiang J, Jiang L, Zhou B, Fu W, Liu JF, Zhang Q: Snat: a SNP annotation tool for bovine by integrating various sources of genomic information. BMC Genetics:85. 37. Pant SD, Schenkel FS, Verschoor CP, You Q, Kelton DF, Moore SS, Karrow NA: A principal component regression based genome wide analysis approach reveals the presence of a novel QTL on BTA7 for MAP resistance in holstein cattle. Genomics 2010, 95(3):176-182.

!

106!

!

Table 1. Details for DP-EBVs mean and SD values for low and high tail pools. N° OF SAMPLES

DP-EBV MEAN

MEAN SD

High tail_1

20

1.257

0.395

DP-EBV REL MEAN 0.493

0.251

0.600

High tail_2

20

1.134

0.285

0.574

N° OF SAMPLES

DP-EBV MEAN

MEAN SD

Low tail_1

20

-1.151

Low tail_2

!

POOL

0.324

DP-EBV REL MEAN 0.535

POOL

19

-1.080

107!

!

Table 2. Significant intragenic SNPs above the Bonferroni genome-wide threshold of 0.05. ILLUMINA SNP NAME

GENBANK SNP CODE

P-Value

BTA

SNP LOCATION

GENE SYMBOL

BovineHD0100007623 BovineHD0100040084 BovineHD0200004154 BovineHD0300000560 BovineHD0300002104 BovineHD0300018913 BovineHD0300023699 BovineHD0400026934 BovineHD0500003126 BovineHD0700010213 BovineHD0900019961 BovineHD1000004333 BovineHD1000009424 BovineHD1000009428 BovineHD1000017503 BovineHD1100003814 BovineHD1300006368 BovineHD1300022672 BovineHD1500008135 Hapmap40064-BTA-36665 BovineHD1500015036 BovineHD1500015037 BTB-00604170 BovineHD1500015042 BovineHD1500015044 BovineHD1500015047 BovineHD1500015049 BovineHD1500015051 BovineHD1500015054 BovineHD1500015055 BovineHD1500015056 BovineHD4100012071 BTA-18105-no-rs BovineHD1600009946 BovineHD1600021693 BovineHD1700002750 BovineHD1700018352 BovineHD1700019237 BovineHD1700019238 BovineHD1700020721 BovineHD1700021131 BovineHD1700021132 BovineHD1900006167 BovineHD4100014346 BovineHD2100001405 ARS-BFGL-NGS-10830 BovineHD2200009526 BovineHD2200009645 BovineHD2200009658 BovineHD2300014695 BovineHD2500003334 BovineHD2500003336

rs137585939 rs43273786 rs110997154 rs110459674 rs110093914 rs42371455 rs135870054 rs109307332 rs134685896 rs133885406 rs136413030 rs43612234 rs43623003 rs110034517 rs42486408 rs109489659 rs109943824 rs41710487 rs134980659 rs41631137 rs41769292 rs134338365 rs41769258 rs41769237 rs109649273 rs41768429 rs41768423 rs41768414 rs41768364 rs109966062 rs41768379 rs136525289 rs109715014 rs41798963 rs41819133 rs110828704 rs135157738 rs110644998 rs134453171 rs109085689 rs135044766 rs135814317 rs134967563 rs29017164 rs133992914 rs109014211 rs110064285 rs135018045 rs133223316 rs110724706 rs42064606 rs109087355

4.43E-08 5.41E-08 3.76E-08 inf 1.87E-08 1.87E-09 8.96E-10 4.69E-08 3.26E-10 4.73E-08 3.70E-08 5.32E-10 6.65E-08 5.56E-09 1.16E-09 5.53E-12 1.12E-08 4.53E-10 6.49E-08 4.65E-12 5.15E-09 2.50E-10 5.84E-10 3.41E-10 6.55E-08 7.66E-12 1.42E-08 6.94E-11 7.12E-08 1.99E-08 9.17E-13 7.93E-09 4.33E-09 4.62E-08 7.33E-08 1.11E-09 2.29E-09 2.43E-10 1.90E-09 4.61E-08 4.88E-08 7.10E-08 7.01E-10 2.41E-13 6.47E-08 1.74E-09 8.84E-09 3.20E-08 5.38E-09 4.60E-09 1.77E-08 2.45E-09

1 1 2 3 3 3 3 4 5 7 9 10 10 10 10 11 13 13 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 16 16 17 17 17 17 17 17 17 19 19 21 21 22 22 22 23 25 25

26254309 141228619 15142189 2612333 7276675 66866123 87296944 98543003 12834395 33526558 73355572 12722576 28079552 28102288 60793897 11771322 20845530 78416778 28399876 33953859 50730325 50733648 50753778 50765770 50769861 50774198 50780537 50784307 50792403 50795681 50799229 51638163 62952170 31290905 71743691 10472292 64466089 67344705 67347843 72364594 73638738 73640453 20731168 57590345 6826694 14303664 33753508 34006051 34051778 50469508 13011549 13017281

ROBO1 NEK11 SSFA2 TADA1 DDR2 LPHN2 ALG6 PLXNA4 ACSS3 HSD17B4 VNN1 MEGF11 MIR2284Z-1 MIR2284Z-1 TRPM7 CCT7 PLXDC2 KCNB1 THY1 PIK3C2A NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 PDE2A CCDC73 CEP170 CAMK1G NR3C2 RPH3A CORO1C CORO1C MTMR3 DEPDC5 DEPDC5 SSH2 ATP5H IGF1R SLCO3A1 FAM19A1 FAM19A1 FAM19A1 TUBB2B SHISA9 SHISA9

Genes and SNPs location as in the Btau4.6.1 assembly; gene symbol as in GenBank.

!

108!

!

Table 3. List of chromosome regions strongly associated to SCS. 21632949

LENGHT (BP) 7488

N. SNPs 3

28017039

202579

7

2

117668432 118739748

1071316

9

3 4 9 13 15

6388643 6396280 117852857 118898784 72784616 72804256 78273095 78416778 28399876 28999494

7637 1045927 19640 143683 599618

3 4 4 4 3

15

31285729

32027462

741733

5

15

50438721

51638163

1199442

14

17 # 21 22

67344705 60154246 33753508

67375670 60175026 34051778

30965 20780 298270

3 4 3

BTA

START*

END*

1

21625461

1

27814460

#

!

GENBANK SNP CODE rs110141424; rs42365792; rs42367069 rs135454183; rs110174548; rs134436790; rs136371716; rs111001290; rs41586446; rs110002182 rs134103593; rs109545959; rs133621389; rs135143470; rs136343471; rs109908642; rs133815275; rs135205101; rs43320680 rs110787209; rs42458782; rs132773940 rs133335423; rs43417362; rs133867064; rs136879377 rs41662464; rs109049649; rs41662465; rs136413030 rs41634068; rs137320993; rs109123247; rs41710487 rs134980659; rs41754552; rs110269361 rs135835073; rs29018094; rs110325464; rs43299708; rs43299703 rs137687321; rs108941833; rs41769292; rs134338365; rs41769258; rs41769237; rs109649273; rs41768429; rs41768423; rs41768414; rs41768364; rs109966062; rs41768379; rs136525289 rs110644998; rs134453171; rs41850009 rs29018575; rs42236250; rs42236274; rs109897238 rs110064285; rs135018045; rs133223316

Start. End*: candidate region start and end (bp) Start and End position referred to Btau4.6.1 assembl

109!

!

Figure 1. Q-Q plot of SNPs at marker level (p-values).

Figure 2. Manhattan plot of genome-wide associations for SCS in Valdostana Red Pied breed. The red line represents the Bonferroni correction threshold.

!

110!

!

Additional file Additional file 1. List of the significant SNPs identified in the Valdostana Red Pied breed. SNP LOCATION Btau4.6.1 7578168 7617863 21625461 21626268 21632949 26254309 27814460 28007458 28011000 28012675 28013437 28015340 28017039 37345318 58471459 NA 125505033 141228619 12523892 15142189 22305417 42800586 51067581 117668432 118307083 118311005 118311614 118316537 118318722 118520597 118532566 118739748 123878559 132282060 133678668 140889824 2612333 6388643 6392715 6396280 7276675 66866123 87296944 NA

GENE SYMBOL (UMD3.1)

GENE SYMBOL (Btau4.6.1)

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3

SNP LOCATION UMD3.1 7719210 7758076 21392476 21393283 21400228 25854635 27267091 27457470 27461010 27462684 27463446 27465349 27467048 36519141 58292531 93793831 124142939 140263787 12207127 14690055 21674287 41699309 49678936 112544408 113184258 113188017 113188626 113193549 113195734 113394404 113406371 113610357 119182414 127361853 128626101 135577686 2093487 5676318 5680627 5684191 6699584 63185254 82527720 86546042

ROBO1

ROBO1

NEK11

NEK11

4,69E-08 3,65E-08 1,33E-08 2,23E-08 3,67E-09 6,78E-08 4,03E-08 2,37E-09 1,68E-11 3,26E-10 5,04E-08 1,29E-08 5,80E-08 4,52E-14 4,93E-08 9,44E-09 2,15E-08 1,72E-08 2,20E-08 5,88E-09 1,14E-08 3,03E-08 1,75E-08 3,92E-08 4,73E-08 5,95E-10 6,20E-08 1,27E-09 4,11E-10 2,86E-08

4 4 4 4 4 4 4 5 5 5 5 5 5 5 5 6 6 6 6 6 6 7 7 7 7 8 8 8 8 9

96635633 113410262 113491345 114993038 115498539 115563215 116067636 5913578 10759058 10792875 13065161 72963752 108300221 117557538 117568421 19542495 47890814 57562332 84252180 84265468 91964609 14010306 23275178 30002652 35679243 8560601 24782491 101005762 101009106 37514911

98543003 116268808 116347881 117852857 118340933 118405576 118898784 6327862 NA 12834395 15164797 77528326 114122159 NA NA 19696350 47615237 58114205 NA NA 93410115 11160093 NA 27548813 33526558 8576004 26295529 104278477 104281820 39325613

rs41662464

1,58E-08

9

71162153

72804256

BovineHD0900019716

rs109049649

4,62E-09

9

71163463

72784616

BovineHD4100007550 BovineHD0900019961

rs41662465 rs136413030

1,60E-11 3,70E-08

9 9

71181789 71844127

72802946 73355572

ILLUMINA SNP NAME

GENBANK SNP CODE

P-VALUE

BTA

BovineHD0100002474 BovineHD0100002486 BovineHD0100006355 BTB-01210076 BovineHD0100006362 BovineHD0100007623 BovineHD0100008100 BovineHD0100008178 BovineHD0100008181 BovineHD0100008182 BovineHD0100008183 Hapmap50048-BTA-59263 BovineHD0100008185 BovineHD0100010452 BovineHD0100016492 BovineHD0100047111 BovineHD0100035049 BovineHD0100040084 BovineHD0200003441 BovineHD0200004154 BovineHD0200006189 BovineHD0200012099 BovineHD0200014323 BovineHD0200032375 BovineHD0200032591 BovineHD0200032593 BovineHD0200032594 BovineHD0200032600 BovineHD0200032602 BovineHD0200032671 BovineHD0200032675 BovineHD0200032735 BovineHD0200034409 BovineHD0200036972 BovineHD0200037360 BovineHD0200039687 BovineHD0300000560 BovineHD0300001752 BovineHD0300001754 BovineHD0300001755 BovineHD0300002104 BovineHD0300018913 BovineHD0300023699 BovineHD0300024738

rs137725625 rs134021632 rs110141424 rs42365792 rs42367069 rs137585939 rs135454183 rs110174548 rs134436790 rs136371716 rs111001290 rs41586446 rs110002182 rs134558019 rs110467395 rs137083739 rs137041533 rs43273786 rs133588497 rs110997154 rs136280214 rs43305393 rs135901001 rs134103593 rs109545959 rs133621389 rs135143470 rs136343471 rs109908642 rs133815275 rs135205101 rs43320680 rs135912109 rs109385272 rs111014754 rs132819804 rs110459674 rs110787209 rs42458782 rs132773940 rs110093914 rs42371455 rs135870054 rs43353415

5,70E-08 1,85E-09 3,18E-08 6,15E-08 2,47E-08 4,43E-08 2,27E-09 3,08E-08 2,71E-08 4,69E-08 5,40E-09 5,03E-08 1,44E-08 4,74E-08 2,67E-08 3,35E-11 3,21E-14 5,41E-08 1,94E-12 3,76E-08 6,02E-09 2,78E-08 3,93E-08 6,77E-08 4,53E-08 2,45E-11 3,26E-10 4,86E-08 1,32E-12 3,72E-10 3,25E-08 1,42E-08 1,54E-08 8,78E-09 6,28E-09 6,52E-08 inf 3,92E-13 1,39E-11 1,17E-14 1,87E-08 1,87E-09 8,96E-10 1,69E-08

BovineHD0400026934 BovineHD0400032670 BovineHD0400032690 BovineHD0400033263 BovineHD0400033469 BovineHD0400033488 BovineHD0400033665 BovineHD0500001585 BovineHD0500003106 BovineHD0500003126 BovineHD0500003925 BovineHD0500020666 BovineHD0500031184 BovineHD0500034148 BovineHD0500034150 BovineHD0600005426 BovineHD0600013116 BovineHD0600015748 BovineHD0600023179 BovineHD0600023185 BovineHD0600025253 BovineHD0700003681 ARS-BFGL-NGS-112444 BovineHD0700008448 BovineHD0700010213 BovineHD0800002755 BovineHD0800007500 BovineHD0800029893 BovineHD0800029896 BovineHD0900010437

rs109307332 rs43422436 rs43415893 rs133335423 rs43417362 rs133867064 rs136879377 rs109553703 rs136127388 rs134685896 rs134449483 rs137104148 rs132800543 rs134479470 rs136956586 rs137467024 rs133682920 rs135342305 rs133319155 rs136907262 rs42615160 rs109949034 NA rs137545102 rs133885406 rs135037740 rs42215668 rs136410732 rs42501093 rs42575049

Hapmap49339-BTA-84110

!

QTL ID

QTL TRAIT

QTL REGION

2491

clinical mastitis

7542199999603227

1742

SCC

6023104-8023104

clinical mastitis clinical mastitis clinical mastitis clinical

4947798876680782 4947798876680782 4947798876680782 49477988-

SSFA2 SP140L

ZNF683 TADA1

TADA1

DDR2 LPHN2 ALG6

DDR2 LPHN2 ALG6

PLXNA4

PLXNA4

ACSS3 ACSS3

ACSS3

C6H4orf19

HSD17B4

HSD17B4

VNN1

1745 1745 VNN1

1745 1745

111!

! mastitis

76680782

SCC SCC SCC

5506264-25860118 5506264-25860118 5506264-25860118

4985

clinical mastitis clinical mastitis clinical mastitis clinical mastitis clinical mastitis

1386810429490317 1386810429490317 1386810429490317 1386810429490317 1386810429490317

31391827

2778

SCS

33465218

31437551

2778

SCS

15

34029055

32026910

2778

SCS

3,60E-08 4,65E-12 2,10E-08 6,46E-08 2,54E-08 5,15E-09 2,50E-10 5,84E-10 3,41E-10 6,55E-08 7,66E-12 1,42E-08 6,94E-11 7,12E-08 1,99E-08 9,17E-13 7,93E-09 1,36E-09 2,68E-09 1,23E-09 4,33E-09 4,62E-08 7,33E-08 1,11E-09 2,01E-08 5,71E-08 2,29E-09 2,43E-10 1,90E-09 2,31E-08 2,73E-08 4,61E-08 4,88E-08 7,10E-08 4,23E-10 7,01E-10 4,57E-08 4,52E-08 1,85E-08 2,41E-13 6,47E-08

15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 15 16 16 17 17 17 17 17 17 17 17 17 17 17 19 19 19 19 19 19 21

34029604 35873422 42159894 51975113 52094874 52107961 52111223 52131353 52143337 52147428 52151765 52158101 52161871 52169973 52173251 52176798 52993385 54462811 59908603 59913013 64168198 34743597 75621260 9808520 26106136 62982492 63725088 66513466 66516604 66544435 70548656 71240044 72513026 72514741 2604934 21492405 36316508 53803085 56365338 57020892 6826694

32027462 33953859 40426557 50438721 50717333 50730325 50733648 50753778 50765770 50769861 50774198 50780537 50784307 50792403 50795681 50799229 51638163 53189677 58736392 58740802 62952170 31290905 71743691 10472292 27406155 62982492 64466089 67344705 67347843 67375670 71645885 72364594 73638738 73640453 1497119 20731168 36523730 54329700 57026445 57590345 6826694

2778

SCS

3151537833515378 3151537833515378 3151537833515378 3151537833515378

rs109014211

1,74E-09

21

15345488

14303664

5451 1708

clinical mastitis SCC

8909340-26179970 8978647-20054369

rs110071682 rs29018575 rs42236250 rs42236274 rs109897238 rs110821186

1,85E-08 1,84E-08 1,88E-10 5,70E-09 4,46E-09 2,89E-08

21 21 21 21 21 22

36898862 60154246 60156822 60173163 60175026 11932652

36616455 NA NA NA NA 12014326

BovineHD1000000101 BovineHD1000004333

rs135481686 rs43612234

6,36E-09 5,32E-10

10 10

461041 12893029

NA 12722576

BovineHD1000009424

rs43623003

6,65E-08

10

28732407

28079552

BovineHD1000009428 BovineHD1000017503 BovineHD1100003814 BovineHD1100003818 BovineHD1100004129 BovineHD1100014224 BovineHD1100016327 BovineHD1200020095 BovineHD1300006368 BovineHD4100010442 BovineHD1300022626 BovineHD1300022630 BovineHD1300022672 BovineHD1500001239

rs110034517 rs42486408 rs109489659 rs134575850 rs109878012 rs134822269 rs134809352 rs134063113 rs109943824 rs41634068 rs137320993 rs109123247 rs41710487 rs42595411

5,56E-09 1,16E-09 5,53E-12 5,33E-08 5,46E-08 3,49E-08 3,75E-08 6,89E-08 1,12E-08 3,19E-08 2,38E-09 1,54E-08 4,53E-10 5,49E-08

10 10 11 11 11 11 11 12 13 13 13 13 13 15

28741867 59867344 11292682 11300974 12535496 48432001 55905582 72740699 21852047 78137874 78145838 78163033 78282460 5153883

28102288 60793897 11771322 11871895 13127338 50274524 57584171 NA 20845530 78273095 78280335 78297531 78416778 3849717

BovineHD1500007318

rs136596272

2,37E-10

15

27339214

25223587

4985

BovineHD1500007427

rs134799988

4,88E-08

15

27670811

25558182

4985

BovineHD1500008135

rs134980659

6,49E-08

15

30514604

28399876

BovineHD1500008366

rs41754552

4,32E-08

15

31105101

28993968

4985

BovineHD1500008367 BovineHD1500009024

rs110269361 rs135835073

1,02E-08 7,58E-10

15 15

31110621 33313379

28999494 31285729

BovineHD4100011940

rs29018094

7,59E-09

15

33419454

BovineHD1500009068

rs110325464

6,90E-11

15

BovineHD1500009221

rs43299708

8,37E-09

BovineHD1500009222 Hapmap40064-BTA-36665 BovineHD1500011688 BovineHD1500014997 BovineHD1500025874 BovineHD1500015036 BovineHD1500015037 BTB-00604170 BovineHD1500015042 BovineHD1500015044 BovineHD1500015047 BovineHD1500015049 BovineHD1500015051 BovineHD1500015054 BovineHD1500015055 BovineHD1500015056 BovineHD4100012071 BovineHD1500015732 BovineHD1500017243 BovineHD1500017244 BTA-18105-no-rs BovineHD1600009946 BovineHD1600021693 BovineHD1700002750 BovineHD1700007360 BovineHD4100013230 BovineHD1700018352 BovineHD1700019237 BovineHD1700019238 BovineHD1700019246 BovineHD1700020540 BovineHD1700020721 BovineHD1700021131 BovineHD1700021132 BovineHD1900000597 BovineHD1900006167 BovineHD1900010531 BovineHD1900015066 BovineHD1900015929 BovineHD4100014346 BovineHD2100001405

rs43299703 rs41631137 rs137114551 rs137687321 rs108941833 rs41769292 rs134338365 rs41769258 rs41769237 rs109649273 rs41768429 rs41768423 rs41768414 rs41768364 rs109966062 rs41768379 rs136525289 rs41769333 rs42595490 rs42595494 rs109715014 rs41798963 rs41819133 rs110828704 rs134414083 NA rs135157738 rs110644998 rs134453171 rs41850009 rs41851405 rs109085689 rs135044766 rs135814317 rs132787142 rs134967563 rs41916837 rs132720248 rs133890886 rs29017164 rs133992914

ARS-BFGL-NGS-10830 BovineHD2100010844 BovineHD4100015306 BovineHD2100017446 BovineHD2100017451 ARS-BFGL-NGS-42178 BovineHD2200003506

!

MEGF11

TRPM7

MEGF11 MIR2284Z1 MIR2284Z1 TRPM7 CCT7

1693 1693 1693

REEP1 PLXDC2

PLXDC2

KCNB1

KCNB1

THY1

PIK3C2A

THY1

4985

PIK3C2A

STIM1 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98

NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 NUP98 PDE2A

CCDC73 CEP170 CAMK1G NR3C2

CCDC73 CEP170 CAMK1G NR3C2

RBM19 RPH3A CORO1C CORO1C

RPH3A CORO1C CORO1C

MTMR3 DEPDC5 DEPDC5

MTMR3 DEPDC5 DEPDC5 SSH2

ATP5H IGF1R SLCO3A1

SLCO3A1

112!

! 3262872743319438 3262872743319438 3262872743319438 3262872743319438

BovineHD2200009526

rs110064285

8,84E-09

22

33187687

33753508

FAM19A1

FAM19A1

4987

SCS

BovineHD2200009645

rs135018045

3,20E-08

22

33440399

34006051

FAM19A1

FAM19A1

4987

SCS

BovineHD2200009658

rs133223316

5,38E-09

22

33487012

34051778

FAM19A1

FAM19A1

4987

SCS

BovineHD2200010551 BovineHD2200017991 BovineHD2300003999 BTA-55613-no-rs BovineHD2300014695

rs110495093 rs133442856 rs109020826 rs41640755 rs110724706

1,27E-09 4,16E-09 1,85E-08 8,70E-09 4,60E-09

22 22 23 23 23

37118913 47632083 15651922 15656140 50379740

37824479 47969909 16146305 16150523 50469508

4987

SCS

TUBB2B

TUBB2B

BovineHD2500003334

rs42064606

1,77E-08

25

11926465

13011549

SHISA9

SHISA9

1751

BovineHD2500003336 BovineHD2500005013 BovineHD2500005088 BovineHD2600004216 BovineHD2600009267 BovineHD2700001072 BovineHD2700001075 BovineHD2700002962 BovineHD2900004558

rs109087355 rs110718749 rs110865743 rs109614481 rs132886180 rs110001968 rs109557235 rs110992741 rs133088106

2,45E-09 2,72E-09 1,24E-10 2,00E-08 9,62E-09 6,84E-09 5,64E-09 2,77E-11 3,21E-08

25 25 25 26 26 27 27 27 29

11932191 17747440 18059161 16809329 34258305 3211214 3215100 9887995 15410280

13017281 18806275 19115600 17451400 34514978 4392694 4396580 11837558 16151571

SHISA9

SHISA9

1751

clinical mastitis clinical mastitis

2689

SCS

0-21729091

2712 2712 2712

SCC SCC SCC

4223574-11982501 4223574-11982501 4223574-11982501

ARS-BFGL-NGS-97397

rs110652594

1,31E-09

29

16353986

17429138

13249

SCS

1625359718253597

!

SORBS1

0-17024171 0-17024171

113!

!

Additional file 2. List biological processes, cellular components, molecular function and metabolic pathways obtained with the annotation analyses performed with DAVID on line Database GENE SYMBOL (GENE

GO and KEGG ANNOTATION

LIST OF BIOLOGICAL PROCESSES (BP), CELLULAR COMPONENTS (CC), MOLECULAR FUNCTION (MF) AND METABOLIC PATHWAYS (KEGG)

FULL NAME)

GOTERM_BP_FAT

ATP5H (ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d)

GOTERM_CC_FAT

GOTERM_MF_FAT KEGG_PATHWAY DEPDC5 (DEP domain containing 5) NEK11 (NIMA (never in mitosis gene a)- related kinase 11)

THY1 (Thy-1 cell surface antigen)

!

GOTERM_BP_FAT GOTERM_BP_FAT

GOTERM_MF_FAT

GOTERM_BP_FAT

generation of precursor metabolites and energy, oxidative phosphorylation, purine nucleotide metabolic, purine nucleotide biosynthetic, ATP biosynthetic, phosphorus metabolic, phosphate metabolic, ion transport, cation transport, hydrogen transport, nucleoside triphosphate metabolic, nucleoside triphosphate biosynthetic, purine nucleoside triphosphate metabolic, purine nucleoside triphosphate biosynthetic, purine ribonucleotide metabolic, purine ribonucleotide biosynthetic, nucleotide biosynthetic, ribonucleoside triphosphate metabolic, ribonucleoside triphosphate biosynthetic, purine ribonucleoside triphosphate metabolic, purine ribonucleoside triphosphate biosynthetic, ribonucleotide metabolic, ribonucleotide biosynthetic, monovalent inorganic cation transport, energy coupled proton transport, down electrochemical gradient, ATP synthesis coupled proton transport, proton transport, phosphorylation, ion transmembrane transport, nucleobase, nucleoside and nucleotide biosynthetic, nucleobase, nucleoside, nucleotide and nucleic acid biosynthetic, nitrogen compound biosynthetic, ATP metabolic, transmembrane transport mitochondrial proton-transporting ATP synthase complex, coupling factor F(o), mitochondrion, mitochondrial envelope, mitochondrial inner membrane, mitochondrial proton-transporting ATP synthase complex, protontransporting two-sector ATPase complex, organelle inner membrane, organelle membrane, mitochondrial membrane, organelle envelope, envelope, proton-transporting two-sector ATPase complex, proton-transporting domain, mitochondrial part, mitochondrial membrane part, proton-transporting ATP synthase complex, proton-transporting ATP synthase complex, coupling factor F(o) monovalent inorganic cation transmembrane transporter activity, hydrogen ion transmembrane transporter activity, inorganic cation transmembrane transporter activity Oxidative phosphorylation, Alzheimer's disease, Parkinson's disease, Huntington's disease intracellular signaling cascade protein amino acid phosphorylation, phosphorus metabolic, phosphate metabolic, phosphorylation nucleotide binding, nucleoside binding, purine nucleoside binding, protein kinase activity, protein serine/threonine kinase activity, ATP binding, purine nucleotide binding, adenyl nucleotide binding, ribonucleotide binding, purine ribonucleotide binding, adenyl ribonucleotide binding angiogenesis, blood vessel development, eye development, eye photoreceptor cell differentiation, vasculature development, activation of immune response, immune response-activating cell surface receptor signaling pathway, negative regulation of immune system, positive regulation of immune system, regulation of leukocyte activation, positive regulation of leukocyte activation, immune response-activating signal transduction, immune response-regulating signal transduction, immune response-regulating cell surface receptor signaling pathway, negative regulation of protein kinase activity, cytoskeleton organization, cell-substrate junction assembly, cell adhesion, cell-matrix adhesion, cell surface receptor linked signal transduction, sensory organ development, negative regulation of signal transduction, regulation of calcium ion transport into cytosol, positive regulation of calcium ion transport into cytosol, negative regulation of cell communication, negative regulation of cell development, regulation of cell morphogenesis involved in differentiation, regulation of metal ion transport, regulation of neuron projection development, cell-cell adhesion, regulation of phosphate metabolic, regulation of cell morphogenesis, biological adhesion, neuron differentiation, regulation of cell migration, negative regulation of cell migration, regulation of cell projection organization, negative regulation of cell projection organization, cell-substrate adhesion, regulation of homeostatic, positive regulation of homeostatic, negative regulation of kinase activity, cell junction assembly, cell

114!

!

GOTERM_CC_FAT

GOTERM_MF_FAT

KEGG_PATHWAY GOTERM_CC_FAT ACSS3 (acyl-CoA synthetase shortchain family member 3)

GOTERM_MF_FAT

KEGG_PATHWAY ALG6 (asparaginelinked glycosylation 6, alpha-1,3glucosyltransferas e homolog (S. cerevisiae))

GOTERM_CC_FAT

KEGG_PATHWAY GOTERM_BP_FAT

CAMK1G (calcium/calmoduli n-dependent protein kinase IG)

GOTERM_CC_FAT

CCT7 (chaperonin

GOTERM_BP_FAT

!

GOTERM_MF_FAT

junction organization, regulation of locomotion, negative regulation of locomotion, regulation of phosphorylation, photoreceptor cell development, eye photoreceptor cell development, retinal cone cell differentiation, cameratype eye development, positive regulation of catalytic activity, negative regulation of catalytic activity, regulation of GTPase activity, regulation of ion transport, positive regulation of ion transport, positive regulation of GTPase activity, regulation of kinase activity, negative regulation of molecular function, positive regulation of molecular function, negative regulation of cell differentiation, regulation of neuron differentiation, regulation of protein kinase activity, photoreceptor cell differentiation, retinal cone cell development, focal adhesion formation, blood vessel morphogenesis, positive regulation of response to stimulus, eye morphogenesis, camera-type eye morphogenesis, neuron development, regulation of neurogenesis, negative regulation of neurogenesis, regulation of axonogenesis, negative regulation of axonogenesis, positive regulation of immune response, antigen receptormediated signaling pathway, T cell receptor signaling pathway, regulation of antigen receptor-mediated signaling pathway, regulation of T cell receptor signaling pathway, negative regulation of antigen receptor-mediated signaling pathway, negative regulation of T cell receptor signaling pathway, regulation of T cell activation, regulation of cell activation, positive regulation of cell activation, positive regulation of T cell activation, positive regulation of transport, negative regulation of cellular component organization, regulation of phosphorus metabolic, regulation of lymphocyte activation, positive regulation of lymphocyte activation, regulation of cell motion, negative regulation of cell motion, regulation of release of sequestered calcium ion into cytosol, positive regulation of release of sequestered calcium ion into cytosol, regulation of hydrolase activity, regulation of transferase activity, positive regulation of hydrolase activity, negative regulation of transferase activity, regulation of calcium ion transport, positive regulation of calcium ion transport, regulation of nervous system development, retina development in camera-type eye, retina morphogenesis in camera-type eye, camera-type eye photoreceptor cell differentiation, regulation of cell development endoplasmic reticulum, plasma membrane, external side of plasma membrane, cell surface, dendrite, growth cone, site of polarized growth, intrinsic to membrane, anchored to membrane, intrinsic to plasma membrane, intrinsic to external side of plasma membrane, anchored to external side of plasma membrane, cell projection, neuron projection, plasma membrane part, membrane raft, anchored to plasma membrane small GTPase regulator activity, GTPase activator activity, Ras GTPase activator activity, Rho GTPase activator activity, integrin binding, phospholipid binding, enzyme activator activity, lipid binding, GTPase regulator activity, protein complex binding, GPI anchor binding, phosphoinositide binding, nucleoside-triphosphatase regulator activity Leukocyte transendothelial migration mitochondrion nucleotide binding, nucleoside binding, purine nucleoside binding, acetateCoA ligase activity, ATP binding, CoA-ligase activity, ligase activity, forming carbon-sulfur bonds, acid-thiol ligase activity, purine nucleotide binding, adenyl nucleotide binding, ribonucleotide binding, purine ribonucleotide binding, adenyl ribonucleotide binding Propanoate metabolism endoplasmic reticulum, endoplasmic reticulum membrane, endomembrane system, organelle membrane, nuclear envelope-endoplasmic reticulum network, endoplasmic reticulum part N-Glycan biosynthesis protein amino acid phosphorylation, phosphorus metabolic, phosphate metabolic, phosphorylation plasma membrane, calcium- and calmodulin-dependent protein kinase complex, endomembrane system nucleotide binding, nucleoside binding, purine nucleoside binding, protein kinase activity, protein serine/threonine kinase activity, calmodulin-dependent protein kinase activity, ATP binding, purine nucleotide binding, adenyl nucleotide binding, ribonucleotide binding, purine ribonucleotide binding, adenyl ribonucleotide binding protein folding

115!

! containing TCP1, subunit 7 (eta))

GOTERM_CC_FAT GOTERM_MF_FAT

GOTERM_BP_FAT DDR2 (discoidin domain receptor tyrosine kinase 2) GOTERM_MF_FAT

HSD17B4 (hydroxysteroid (17-beta) dehydrogenase 4)

GOTERM_BP_FAT

GOTERM_CC_FAT KEGG_PATHWAY

GOTERM_BP_FAT

IGF1R (insulin-like growth factor 1 receptor) GOTERM_CC_FAT

GOTERM_MF_FAT

KEGG_PATHWAY

LPHN2 (latrophilin 2) MTMR3 (myotubularin

!

GOTERM_BP_FAT GOTERM_CC_FAT GOTERM_MF_FAT GOTERM_BP_FAT GOTERM_MF_FAT

cytosol, chaperonin-containing T-complex, cytosolic part nucleotide binding, nucleoside binding, purine nucleoside binding, ATP binding, purine nucleotide binding, adenyl nucleotide binding, ribonucleotide binding, purine ribonucleotide binding, adenyl ribonucleotide binding, identical protein binding, unfolded protein binding protein amino acid phosphorylation, phosphorus metabolic, phosphate metabolic, cell adhesion, cell surface receptor linked signal transduction, enzyme linked receptor protein signaling pathway, transmembrane receptor protein tyrosine kinase signaling pathway, positive regulation of cell proliferation, phosphorylation, biological adhesion, regulation of cell proliferation nucleotide binding, nucleoside binding, purine nucleoside binding, protein kinase activity, protein tyrosine kinase activity, transmembrane receptor protein tyrosine kinase activity, ATP binding, purine nucleotide binding, adenyl nucleotide binding, ribonucleotide binding, purine ribonucleotide binding, adenyl ribonucleotide binding very-long-chain fatty acid metabolic, reproductive developmental, fatty acid metabolic, fatty acid beta-oxidation, sex differentiation, gonad development, male gonad development, fatty acid catabolic, lipid catabolic, organic acid catabolic, fatty acid oxidation, lipid modification, lipid oxidation, cellular lipid catabolic, development of primary sexual characteristics, carboxylic acid catabolic, development of primary male sexual characteristics, male sex differentiation, reproductive structure development, reproductive cellular, oxidation reduction, Sertoli cell differentiation, Sertoli cell development mitochondrion, peroxisome, microbody Primary bile acid biosynthesis reproductive developmental, regulation of DNA replication, protein complex assembly, protein amino acid phosphorylation, phosphorus metabolic, phosphate metabolic, immune response, cell surface receptor linked signal transduction, enzyme linked receptor protein signaling pathway, transmembrane receptor protein tyrosine kinase signaling pathway, intracellular signaling cascade, sex determination, positive regulation of biosynthetic, positive regulation of macromolecule biosynthetic, positive regulation of macromolecule metabolic, phosphorylation, second-messengermediated signaling, male sex determination, regulation of cell migration, positive regulation of cell migration, mammary gland development, positive regulation of cellular biosynthetic, regulation of locomotion, positive regulation of locomotion, macromolecular complex subunit organization, positive regulation of DNA replication, positive regulation of nucleobase, nucleoside, nucleotide and nucleic acid metabolic, protein amino acid autophosphorylation, insulin-like growth factor receptor signaling pathway, phosphoinositide-mediated signaling, gland development, regulation of DNA metabolic, positive regulation of DNA metabolic, positive regulation of nitrogen compound metabolic, protein oligomerization, protein tetramerization, regulation of cell motion, positive regulation of cell motion, macromolecular complex assembly, protein complex biogenesis cell fraction, membrane fraction, insoluble fraction, microsome, integral to membrane, intrinsic to membrane, vesicular fraction nucleotide binding, nucleoside binding, purine nucleoside binding, protein kinase activity, protein tyrosine kinase activity, transmembrane receptor protein tyrosine kinase activity, insulin receptor binding, insulin-like growth factor binding, ATP binding, peptide hormone binding, purine nucleotide binding, growth factor binding, enzyme binding, kinase binding, adenyl nucleotide binding, insulin-like growth factor I binding, protein complex binding, ribonucleotide binding, purine ribonucleotide binding, adenyl ribonucleotide binding, peptide binding, hormone binding, identical protein binding, phosphoinositide 3-kinase binding, insulin binding, insulin receptor substrate binding Oocyte meiosis, Endocytosis, Focal adhesion, Adherens junction, Long-term depression, Progesterone-mediated oocyte maturation, Pathways in cancer, Colorectal cancer, Glioma, Prostate cancer, Melanoma cell surface receptor linked signal transduction, G-protein coupled receptor protein signaling pathway, neuropeptide signaling pathway plasma membrane, integral to membrane, intrinsic to membrane sugar binding, carbohydrate binding phosphorus metabolic, phosphate metabolic, dephosphorylation phosphatase activity

116!

! related protein 3)

KEGG_PATHWAY

regulation of nucleotide metabolic, purine nucleotide metabolic, purine nucleotide catabolic, nucleoside monophosphate metabolic, nucleoside monophosphate catabolic, purine nucleoside monophosphate metabolic, purine nucleoside monophosphate catabolic, purine ribonucleotide metabolic, purine ribonucleotide catabolic, ribonucleoside monophosphate catabolic, ribonucleoside monophosphate metabolic, nucleotide catabolic, purine ribonucleoside monophosphate metabolic, purine ribonucleoside monophosphate catabolic, ribonucleotide metabolic, ribonucleotide catabolic, regulation of cyclic nucleotide metabolic, regulation of cAMP metabolic, nucleobase, nucleoside, nucleotide and nucleic acid catabolic, nucleobase, nucleoside and nucleotide catabolic, nitrogen compound catabolic, GMP metabolic, GMP catabolic, heterocycle catabolic, extrinsic to membrane nucleotide binding, nucleoside binding, purine nucleoside binding, cyclicnucleotide phosphodiesterase activity, 3',5'-cyclic-nucleotide phosphodiesterase activity, phosphoric diester hydrolase activity, purine nucleotide binding, guanyl nucleotide binding, GMP binding, cyclic nucleotide binding, cGMP binding, ribonucleotide binding, purine ribonucleotide binding, guanyl ribonucleotide binding Purine metabolism

KEGG_PATHWAY

Axon guidance

KEGG_PATHWAY

Taste transduction

GOTERM_BP_FAT

PDE2A (phosphodiesteras e 2A, cGMPstimulated) GOTERM_CC_FAT

GOTERM_MF_FAT

PLXNA4 (plexin A4) KCNB1 (potassium voltage-gated channel, Shabrelated subfamily, member 1)

GOTERM_BP_FAT

RPH3A (rabphilin 3A homolog (mouse))

GOTERM_CC_FAT

GOTERM_MF_FAT ROBO1 (roundabout, axon guidance receptor, homolog 1 (Drosophila)) PIK3C2A (similar to Phosphatidylinosit ol-4-phosphate 3kinase C2 domaincontaining alpha polypeptide (Phosphoinositide 3-) SSH2 (slingshot homolog 2 (Drosophila)) SLCO3A1 (solute carrier organic anion transporter family, member 3A1) TRPM7 (transient receptor potential cation channel, subfamily M, member 7)

!

intracellular protein transport, protein localization, protein transport, cellular protein localization, establishment of protein localization, intracellular transport, cellular macromolecule localization plasma membrane, synaptic vesicle, cytoplasmic membrane-bounded vesicle, cell junction, coated vesicle, clathrin-coated vesicle, cytoplasmic vesicle, vesicle, membrane-bounded vesicle, synapse part, plasma membrane part, synapse small GTPase regulator activity, zinc ion binding, Ras GTPase binding, Rab GTPase binding, enzyme binding, GTPase regulator activity, small GTPase binding, ion binding, cation binding, metal ion binding, transition metal ion binding, GTPase binding, nucleoside-triphosphatase regulator activity

KEGG_PATHWAY

Axon guidance

KEGG_PATHWAY

Inositol phosphate metabolism, Phosphatidylinositol signaling system

KEGG_PATHWAY GOTERM_BP_FAT

protein amino acid dephosphorylation, phosphorus metabolic, phosphate metabolic, dephosphorylation phosphoprotein phosphatase activity, protein tyrosine phosphatase activity, protein tyrosine/serine/threonine phosphatase activity, phosphatase activity Regulation of actin cytoskeleton ion transport

GOTERM_CC_FAT

integral to membrane, intrinsic to membrane

GOTERM_BP_FAT GOTERM_MF_FAT

GOTERM_BP_FAT

GOTERM_MF_FAT

protein amino acid phosphorylation, phosphorus metabolic, phosphate metabolic, ion transport, phosphorylation, transmembrane transport nucleotide binding, nucleoside binding, purine nucleoside binding, protein kinase activity, protein serine/threonine kinase activity, ion channel activity, ATP binding, channel activity, purine nucleotide binding, passive transmembrane transporter activity, substrate specific channel activity, adenyl

117!

!

GOTERM_BP_FAT VNN1 (vanin 1)

GOTERM_CC_FAT GOTERM_MF_FAT KEGG_PATHWAY

!

nucleotide binding, ribonucleotide binding, purine ribonucleotide binding, adenyl ribonucleotide binding acute inflammatory response, chronic inflammatory response, positive regulation of immune system, regulation of leukocyte activation, positive regulation of leukocyte activation, cellular amino acid derivative metabolic, coenzyme metabolic, anti-apoptosis, defense response, inflammatory response, immune response, cell adhesion, response to wounding, regulation of cell death, pantothenate metabolic, cell-cell adhesion, biological adhesion, regulation of T cell differentiation in the thymus, positive regulation of T cell differentiation in the thymus, regulation of apoptosis, negative regulation of apoptosis, regulation of programmed cell death, negative regulation of programmed cell death, innate immune response, regulation of T cell differentiation, positive regulation of T cell differentiation, positive regulation of cell differentiation, regulation of lymphocyte differentiation, positive regulation of lymphocyte differentiation, regulation of T cell activation, regulation of cell activation, positive regulation of cell activation, positive regulation of T cell activation, positive regulation of developmental, cofactor metabolic, regulation of lymphocyte activation, positive regulation of lymphocyte activation, negative regulation of cell death plasma membrane, intrinsic to membrane, anchored to membrane hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides, pantetheine hydrolase activity Pantothenate and CoA biosynthesis

118!

!

Additional file 3. List of the genes mapping in QTL associated to traits of economic importance in bovine GENE SYMBOL

NR3C2

FULL GENE NAME

nuclear receptor subfamily 3, group C, member 2

ID 1356 10534 10533 10532 10531 10536 10535

CORO1C

coronin, actin binding protein, 1C

NEK11

NIMA (never in mitosis gene a)- related kinase 11

PLXDC2

plexin domain containing 2

TADA1L

Transcriptional adapter 1like protein

LPHN2

Latrophilin-2 Precursor

PLXNA4

plexin A4

THY1

ATP5H FAM19A1

!

Thy-1 cell surface antigen

ATP synthase subunit d, mitochondrial family with sequence similarity 19 (chemokine (C-C motif)-like), member

4484 4376 11051 11386 11052 2561 11326 2556 2679 2560 11327 11360 5014 10647 1450 10937 10938 10936 2720 10939 1300 10678-79-81 12143 10685 10677 12144 1325 13158 6053 13157 2442-3 2655 2656 13224-5-6 13222-3 5663 5325 5331 10680 10693 10692 10691 491 10515 4485 4972 13502-3-4 13504 13498 10986 10989 13505 4985 10984 10987 13499-500-501 1391 12175 11140 11142 11149

QTL REGIONS AND ASSOCIATED TRAITS TRAIT QTL region Fat percentage Chr17:0-28901254 Final packed red blood cell volume Chr17:6750519-32301061 PCV variance Chr17:6750519-32301061 PCVF minus PCVM Chr17:6750519-32301061 PCVI minus PCVF Chr17:6750519-32301061 Percentage decrease in PCV up to day 100 after Chr17:6750519-32301061 challenge Percentage decrease in PCV up to day 150 after Chr17:6750519-32301061 challenge Post-weaning average daily gain Chr17:6750519-23354294 Residual feed intake Chr17:10037387-12037387 Calving ease (maternal) Chr17:54265266-72227102 Dystocia (maternal) Chr17:63940959-72227102 Fat thickness at the 12th rib Chr17:63940959-72227102 Milk fat percentage Chr17:42508177-72227102 Milk fat yield (EBV) Chr17:63940959-72227102 Milk protein yield Chr17:42508177-72227102 Milk protein yield Chr17:64476592-72227102 Milk yield Chr17:42508177-72227102 Milk yield (EBV) Chr17:63940959-72227102 Stillbirth (maternal) Chr17:63940959-72227102 Veterinary treatments Chr17:63940959-72227102 Body weight (weaning) Chr1:133500304-156647138 Chest width Chr1:122708689-151468516 Body weight (weaning) Chr13:4537163-28146135 Carcass weight Chr13:15494818-28146135 Fat thickness at the 12th rib Chr13:4537163-28146135 Milk protein percentage Chr13:15832550-28146135 Weaning weight-maternal milk Chr13:15494818-28146135 Body weight (birth) Chr3:0-7545339 Body weight (birth) Chr3:0-15421599 Body weight (slaughter) Chr3:0-5753088 Body weight (weaning) Chr3:0-19119323 Carcass weight Chr3:0-23673607 Carcass weight Chr3:0-5753088 Fat thickness Chr3:0-24894464 Fat thickness at the 12th rib Chr3:0-16258580 Interval to first estrus after calving (EBV) Chr3:0-21939455 Longissimus muscle area Chr3:0-16258580 Milk fat percentage Chr3:0-19119323 Milk fat yield Chr3:0-15320965 Milk protein percentage Chr3:0-15320965 Milk protein yield Chr3:0-11862259 Milk yield Chr3:0-11862259 Non-return rate (direct) Chr3:974625-30143223 Residual feed intake Chr3:0-19119323 Residual feed intake Chr3:0-14976489 Ribeye area Chr3:0-15421599 Body weight (birth) Chr3:57075548-73870850 Body weight (yearling) Chr3:57075548-73870850 Height (mature) Chr3:57075548-73870850 Clinical mastitis Chr4:75421999-99603227 Parasites mean of natural logarithm Chr4:98555994-119913949 Post-weaning average daily gain Chr4:98555994-108527288 Udder depth Chr4:77210987-99603227 Body length Chr15:27792116-29792116 Body length Chr15:27792116-29792116 Body weight (6 months) Chr15:27792116-29792116 Body weight (birth) Chr15:13868104-29490317 Body weight (yearling) Chr15:13868104-29490317 Chest girth Chr15:27792116-29792116 Clinical mastitis Chr15:13868104-29490317 Fat thickness at the 12th rib Chr15:13868104-29490317 Ribeye area Chr15:11545436-29490317 Withers height Chr15:27792116-29792116 Body weight (birth) Chr19:56095743-64812771 Stearic acid content Chr19:56090170-58090170 Body weight (birth) Chr22:12171103-35097286 Body weight (weaning) Chr22:12171103-35097286 Body weight (yearling) Chr22:32628727-43319438

119!

! A1

MEGF11

multiple EGF-like-domains 11

KCNB1

potassium voltage-gated channel, Shab-related subfamily, member 1

TRPM7 PIK3C2A

transient receptor potential cation channel, subfamily M, member 7 phosphoinositide-3-kinase, class 2, alpha polypeptide

ROBO1

roundabout, axon guidance receptor, homolog 1 (Drosophila)

SHISA9

(CKAMP44) shisa homolog 9

!

4672 11141 7105 11147 11144 2487 11143 4987 4988 4692 10864 4524 7091 7118 5007 1306 10950 2671 2670 1585 1584 1589 1588 1586 1587 10875 10219 4826

Calf size (maternal) Calving ease (maternal) Fat percentage Height (mature) Height (yearling) Milk protein percentage Scrotal circumference Somatic cell score Udder depth Angularity Body weight (birth) Carcass weight Fat percentage Meat percentage Veterinary treatments Body weight (yearling) Marbling score (EBV) Milk protein yield Milk yield PTA type Udder attachment Udder composite index Udder depth Udder height Udder width Height (yearling) Milk fat yield (daughter deviation) Tenderness score

Chr22:32628727-43319438 Chr22:12171103-35097286 Chr22:32628727-47692569 Chr22:32628727-43319438 Chr22:12171103-35097286 Chr22:32539717-34539717 Chr22:12171103-35097286 Chr22:32628727-43319438 Chr22:32628727-43319438 Chr10:8292053-15297220 Chr10:8965571-14961698 Chr10:0-20877327 Chr10:0-14961698 Chr10:0-19995511 Chr10:8292053-14961698 Chr13:78375827-82517204 Chr13:77615929-82517204 Chr13:59914941-80170380 Chr13:59914941-80170380 Chr13:59914941-80170380 Chr13:59914941-80170380 Chr13:59914941-80170380 Chr13:59914941-80170380 Chr13:59914941-80170380 Chr13:59914941-80170380 Chr10:56559463-78264482 Chr10:47964403-76680782 Chr10:55424742-78024227

4836

Myofibrillar fragmentation index

Chr15:29490317-40147387

10635 10633 10634 10637 10636 2500 2501 1674 11201 1307 11207 1751 11377 2607 6134

Body weight (birth) Calving ease (direct) Calving ease (maternal) Height (mature) Marbling score (EBV) Milk protein yield Milk yield Udder cleft Body weight (birth) Body weight (yearling) Body weight (yearling) Clinical mastitis Dystocia (maternal) Milk protein percentage Milk protein yield (EBV)

Chr1:11538282-31377557 Chr1:11538282-31377557 Chr1:11538282-31377557 Chr1:11538282-31377557 Chr1:11538282-31377557 Chr1:26284167-33876150 Chr1:26284167-33876150 Chr1:20124367-33876150 Chr25:792146-13184868 Chr25:792146-13449134 Chr25:0-25073950 Chr25:0-17024171 Chr25:0-13184868 Chr25:792146-13449134 Chr25:0-23241144

120!

!

GENERAL CONCLUSION The mapping of CNV in the Brown population identified several CNV Regions that may be considered as possible source of variation in genomic selection for this cattle population. The mapping has been here performed using the Illumina Bovine SNP50 BeadChip array, a medium density one. The limit in the detection of CNVs with this array may be related to the density of the array. In fact the algorithms here used uses Log R Ratio and B allele frequency of the SNP included in the array. The SNPs probe spacing in this tool average 51.5 Kb thus leaving room for misidentification of CNV. The HD SNP Chip is more than 10 times denser with 777K SNP considered. Nevertheless the validation here performed with the qPCR, showed true CNV among those identified. The comparison with results obtained with HD SNP chip in the same population may provide insight on the capability of the tool to identify CNVs. Additionally comparison with other populations may deliver a meta-analysis to identify CNV conserved across populations. During the development on this thesis a CNV mapping in the Valdostana Red Pied has been produced (results not shown). The comparison among the two population is particularly interesting because they derive from a common environment, the Alps, but they undergo in the recent past to a different selection. Common CNV regions among the two breeds may disclosed interesting genomic regions. In genomic selection the imputation is a technique to improve SNP genotype density of individuals. This is particularly used to impute low to high density genotypes of individuals in genomic selections. As CNV may be used as additional markers in calculating prediction equations (and in subsequent genomic selection of individuals), it can be envisaged to develop an imputation process for CNV as done for SNP genotypes. This would be particularly important whenever females will enter genomic evaluation process, because is unlikely that they will be genotyped with HD SNP chip or using genotyping by sequencing. The QTL identified in this thesis for fatty acid components in the Italian Brown Swiss are of particular interest as is the first study on this population. Given the majority of milk is processed for cheese production, the selection for milk quality in the Italian Brown Swiss is undergoing for decades: k-casein variant B is desired and weighted positively in the official selection index. The Brown Association investigated for some year the possibility to improve the selection for quality including in their index true protein content and fatty acid composition. The results here obtained (i.e. heritability estimate and presence of QTL) indicates clearly the possibility to include in the selection objectives the fatty acid !

121!

!

composition. The possibility that the Breeders Association will include in the selection index these objectives is nevertheless linked to the market that such a products will have. The enhanced nutritional value is not, at present market conditions, recognised as an additional economic value by the consumers. Some niche market for milk with added nutritional value is active in France where a farmers cooperative is successfully marketing the “Blue-Blanc-Coeur” milk, a product rich with Omega-3 fatty acid. Finally QTLs mapped for mastitis resistance provide a step forward in the gene mapping research perfused in the Italian dairy cattle populations. The study is here done in a small population using a selective DNA pooling design. This approach allows to overcome the limitation from the small size of the population defining two extreme groups of individuals and identifying the markers with alternative allele frequencies associated with the considered phenotype. This is the first attempt to map QTL with SNP chips genotypes for a health trait is a small native population. This is particularly relevant as the vast majority of research in cattle populations is done in cosmopolitan and large cattle breeds. The possibility to enlarge GWAS studies in small populations is a key challenge to disclosed alleles and genomic variants that may be lost in highly selected breeds.

!

122!