Escherichia coli - The Journal of Immunology

Escherichia coli - The Journal of Immunology

This information is current as of July 22, 2018. Shiga Toxin Produced by Enterohemorrhagic Escherichia coli Inhibits PI3K/NF-κB Signaling Pathway in ...

643KB Sizes 0 Downloads 0 Views

Recommend Documents

Phosphotransferase SystemSugars by Escherichia coli - Journal of
Aug 17, 1982 - ROY A. BLACK,t* ANN C. HOBSON,f AND JULIUS ADLER. Department ofBiochemistry and Department of Genetics, C

Nitric Oxide Formation by Escherichia coli - The Journal of Biological
Mar 31, 2003 - Hughes, M. N., Scott, C., Thomson, A. J., Green, J., and. Poole, R. K. (2002) EMBO J. 21, 3235–3244). F

The Replication of DNA in Escherichia Coli
Jan 28, 2009 - graduated with aPh.D in liberal acts from the University of Chicago. California Institute of Technology a

Escherichia coli - CDC
tions in Guatemala or remaining at least 14 days in Antigua in Guatemala, or in Cuernavaca, Mexico, were included in the

Transcriptional Response of Escherichia coli to TPEN - Journal of
May 12, 2006 - Carbonic anhydrase. 60. B1053. yceE. 2.5. 1.3E-03. Drug resistance protein. 65. B0313. betI. 2.4. 5.9E-03

Escherichia coli - ernährungs umschau
Ursprünglich trugen die Bakterien den. Namen „Bacterium coli commune“. Der. Gattungsname Bacterium deutet auf die m

CD103 - The Journal of Immunology
Jonathan M. G. Higgins,* David G. Binion,‡ and Christina M. Parker2*. Integrins are ...... Abecassis, J., R. Millon-Co

The Escherichia coli AIDA autotransporter adhesin - Microbiology
The Escherichia coli AIDA autotransporter adhesin recognizes an integral membrane glycoprotein as receptor. Sven Laarman

SUPPRESSORS IN ESCHERICHIA COLI* cellular component, the
Abstract.-Two new nonsense suppressors in Escherichia coli were found in ... to generate at least one suppressor for eac

Ether-lipid membrane engineering of Escherichia coli
A mio padre, mia madre e mia sorella per avermi sempre sostenuto, incoraggiato e creduto in me dall'inizio alla fine. Al

This information is current as of July 22, 2018.

Shiga Toxin Produced by Enterohemorrhagic Escherichia coli Inhibits PI3K/NF-κB Signaling Pathway in Globotriaosylceramide-3-Negative Human Intestinal Epithelial Cells Alain P. Gobert, Marjolaine Vareille, Anne-Lise Glasser, Thomas Hindré, Thibaut de Sablet and Christine Martin

References

This article cites 45 articles, 24 of which you can access for free at: http://www.jimmunol.org/content/178/12/8168.full#ref-list-1

Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average

Subscription Permissions Email Alerts

Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.

Downloaded from http://www.jimmunol.org/ by guest on July 22, 2018

J Immunol 2007; 178:8168-8174; ; doi: 10.4049/jimmunol.178.12.8168 http://www.jimmunol.org/content/178/12/8168

The Journal of Immunology

Shiga Toxin Produced by Enterohemorrhagic Escherichia coli Inhibits PI3K/NF-␬B Signaling Pathway in Globotriaosylceramide-3-Negative Human Intestinal Epithelial Cells1 Alain P. Gobert,2* Marjolaine Vareille,* Anne-Lise Glasser,† Thomas Hindre´,* Thibaut de Sablet,* and Christine Martin*

S

higa toxin producing Escherichia coli (STEC)3 are responsible for food-borne toxi-infections. Healthy rearing animals are the main STEC reservoir and human infection occurs through the ingestion of contaminated food. STEC infection may lead to diseases ranging from uncomplicated diarrhea to hemorrhagic colitis and life-threatening complications such as hemolytic-uremic syndrome (HUS); bacterial strains responsible for the more severe symptoms are called enterohemorrhagic E. coli (EHEC). HUS is defined by a triad of microangiopathic hemolytic anemia, thrombocytopenia, and acute renal failure, which can yield to a chronic renal failure and even death. Thus, HUS is considered as the main cause of acute renal disease in children in developed countries (1, 2). Recently, a severe outbreak of EHEC infection and HUS due to contaminated ground beef has been observed in

*Institut National de la Recherche Argonomique, UR454 Unite´ de Microbiologie, Centre de Theix, Saint-Gene`s-Champanelle, France; and †Pathoge´nie Bacte´rienne Intestinale, Laboratoire de Bacte´riologie, USC Institut National de la Recherche Argonomique 2018, Universite´ d’Auvergne, CBRV, Clermont-Ferrand, France Received for publication January 22, 2007. Accepted for publication April 10, 2007. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported in part by grants from the Institut de la Recherche Agronomique (to M.V. and T.H.) and from Re´gion Auvergne (to M.V.). 2 Address correspondence and reprint requests to Dr. Alain P. Gobert, Unite´ de Microbiologie, Institut National de la Recherche Argonomique, Centre de Theix, 63122 Saint-Gene`s-Champanelle, France. E-mail address: [email protected] 3 Abbreviations used in this paper: STEC, Shiga toxin-producing Escherichia coli; HUS, hemolytic-uremic syndrome; EHEC, enterohaemorrhagic Escherichia coli; Stx, Shiga toxin; Gb-3, globotriaosylceramide-3; WT, wild type; DAPI, 4⬘,6⬘-diamidino-2-phenylindole.

Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 www.jimmunol.org

France (3) and was followed in the United States by an outbreak of E. coli O157:H7 infection associated with consumption of spinach, leading to 31 cases of acute renal failure and 5 deaths (4). The main EHEC virulence factors associated with severe human disease are the two Shiga toxins (Stx), Stx1 and Stx2. Stx is an holotoxin constituted by a catalytic A subunit and by five B subunits implicated in the binding to the cellular receptor glycolipid globotriaosylceramide-3 (Gb-3, also identified as CD77). Stx1 and Stx2 are encoded by two type ␭ lysogenic phages integrated in the bacterial genome (5). The expression of stx genes is under the control of a SOS response induced by an external stress causing DNA damages. EHEC-derived Stx is produced in the lower intestine, translocates across intestinal epithelium, reaches the blood, and targets the Gb-3 receptor of endothelial cells. Internalized Stx alters ribosomal functions by an N-glycosidase activity on the 28S RNA and induces the death of vascular endothelial cells (1). Importantly, human enterocytes, as well as the human cell line T84, do not express Gb-3 and are not sensitive to the cytotoxic effect of Stx (6 – 8). Nonetheless, these cells are the first interacting with the bacteria and the implication of Stx on the inflammatory response of the colonic mucosa remains less known. An important hallmark of EHEC pathogenesis is the intestinal colonization resulting in attaching and effacing lesions in epithelial cells and in induction of a strong mucosal innate immune response. Clinical studies have emphasized a correlation between high levels of chemokines and type 1 cytokines and the severity of the disease (9). These proinflammatory mediators synthesized by the infected colonic mucosa recruit and activate cells of the immune system, such as neutrophils or dendritic cells. This inflammatory response may alter the integrity of the epithelial barrier and facilitate the translocation of Stx across the mucosa. As for intracellular pathogens

Downloaded from http://www.jimmunol.org/ by guest on July 22, 2018

Shiga toxin (Stx) produced by enterohemorrhagic Escherichia coli (EHEC) binds to endothelial cells expressing globotriaosylceramide-3 (Gb-3) and induces cell death by inhibiting translation. Nonetheless, the effects of Stx on human enterocytes, which lacks receptor Gb-3, remain less known. In this study, we questioned whether EHEC-derived Stx may modulate cellular signalization in the Gb-3-negative human epithelial cell line T84. Stx produced by EHEC was fixed and internalized by the cells. A weak activation of NF-␬B was observed in T84 cells after EHEC infection. Cells infected with an isogenic mutant lacking stx1 and stx2, the genes encoding Stx, displayed an increased NF-␬B DNA-binding activity. Consequently, the NF-␬B-dependent CCL20 and IL-8 gene transcription and chemokine production were enhanced in T84 cells infected with the Stx mutant in comparison to the wild-type strain. Investigating the mechanism by which Stx modulates NF-␬B activation, we showed that the PI3K/Akt signaling pathway was not induced by EHEC but was enhanced by the strain lacking Stx. Pharmacological inhibition of the PI3K/Akt signalization in EHEC ⌬Stx-infected T84 cells yielded to a complete decrease of NF-␬B activation and CCL20 and IL-8 mRNA expression. This demonstrates that the induction of the PI3K/Akt/NF-␬B pathway is potentially induced by EHEC, but is inhibited by Stx in Gb-3-negative epithelial cells. Thus, Stx is an unrecognized modulator of the innate immune response of human enterocytes. The Journal of Immunology, 2007, 178: 8168 – 8174.

The Journal of Immunology

Materials and Methods Reagents All reagents for cell culture, RNA extraction, and reverse transcription were obtained from Invitrogen Life Technologies. Real-time PCR was performed with the reagents and the apparatus from Roche Diagnostics. Reagents for EMSA, EZ-Detect Transcription Factor Kit, and HRP- and fluorescent-conjugated secondary Ab were purchased from Pierce. The NF-␬B inhibitor Z-Leu-Leu-Leu-CHO (MG132), the PI3K inhibitors, namely, wortmannin and 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4one (LY294002), and the Akt inhibitor (1L6-hydroxymethyl-chiro-inositol2-(R)-2-O-methyl-3-O-octadecyl-sn-glycerocarbonate; see Ref. 17) were obtained from Calbiochem. Stx1, Stx2, and mAb against Stx1 and Stx2 were obtained from Toxin Technology. All others chemicals were obtained from Sigma-Aldrich.

EHEC strain, culture conditions, and mutagenesis The wild-type (WT) EHEC strain EDL933 (18) belonging to the serotype O157:H7 and its isogenic mutant deleted of the stx1 and stx2 genes were isolated on Luria-Bertani agar plates. One clone of each strain was grown overnight at 37°C in Luria-Bertani broth, in the absence or presence of kanamycin (50 ␮g/ml), then diluted and grown in DMEM for 2 h to the exponential growth phase (OD600 ⬃ 0.2); these bacteria were used to infect T84 cells. The bacterial concentration was estimated to be 5 ⫻ 108 bacteria/ml per OD unit at 600 nm, as calculated by plating. The EDL933 stx1/stx2 isogenic mutant was constructed as follow: overlap extension PCR was used to generate a deletion encompassing stx2A and stx2B. Two PCR fragments were obtained from EDL933 DNA by use of the Accu TaqLA DNA polymerase (Sigma-Aldrich) with the primer pairs (Table I) S2A-S2B (918 bp) and S2C-S2D (921 bp). A second PCR with the primer pair S2A-S2D allowed the amplification of a fragment containing the stx2A-stx2B flanking regions and a complete deletion (1238 bp) of stx2A and stx2B. This product was digested with XbaI and cloned into XbaI-digested pBCKS⫹ (Stratagene). The NotI-SalI fragment containing EDL933 DNA was then subcloned into NotI-SalI-digested pKO3 (19). This plasmid was electroporated into EDL933. Cointegration and excision of the suicide vector were performed as described (http://arep.med.harvard.edu/ labgc/pko3.html). The deletion contained in the EDL933 ⌬stx2A/stx2B mutant resulting from the allelic exchange was confirmed by PCR analysis and DNA sequencing. A mutant with deletion and insertion of the gene conferring resistance to kanamycin in the stx1A/stx1B genes of EDL933 ⌬stx2A/stx2B was obtained by using the one-step PCR-based method of Datsenko and Wanner (20). The pKOBEG (21) plasmid was electroporated into EDL933 ⌬stx2A/ stx2B. Strain CH158 (21) was used as a template to amplify its chromosomal copy of a gene conferring resistance to kanamycin, flanked by genespecific sequences. The 5⬘ ends of the primers S1A and S1B (Table I) contained homologous extension sequences, which consisted of the 50 first or of the 50 last nucleotides of the open reading frames to be deleted. The mutant was created by electroporating the host strain carrying pKOBEG with the purified linear PCR product and then plating the organisms on selective agar (20). The allelic exchange was confirmed by PCR analysis

Table I. List of oligonucleotides Primers

S2A S2B S2C S2D S1A S1B CCL20-F CCL20-R IL-8-F IL-8-R Estx1-F Estx1-R Estx2-F Estx2-R EtufA-F EtufA-R Sstx1-F Sstx1-R Sstx2-F Sstx2-R StufA-F StufA-R

Sequences (5⬘–3⬘)

GCTCTAGAGCGCGGAGGGGATTGTTGAAG ACGAATCAGGTTATGCCCATATACAGGTGTTCC GGAACACCTGTATATGGGCATAACCTGATTCGT CGTCTAGAGCGCTTTCGGATGGTTAAGAC ATGAAAATAATTATTTTTAGAGTGCTAACTTTTTT CTTTGTTATCTTTTCAAAGCCACGTTGTGTCTCAA TCAACGAAAAATAACTTCGCTGAATCCCCCTCCAT TATGACAGGCATTAGTTAGAAAAACTCATCGAGCA GCTGCTTTGATGTCAGTGCT TTTGCGCACACAGACAACTT CTCTCTTGGCAGCCTTCCT TGAATTCTCAGCCCTCTTCAA TGTTGCAGGGATCAGTCGTA TGAGGTTCCACTATGCGACA CACATTTACAGTGAAGGTTGA TTCAGCAAATCCGGAGCCTG TGGTTGATGACGAAGAGCTG GCTCTGGTTCCGGAATGTAA CAGAGGAAGGGCGGTTTAAT GCCGGACACATAGAAGGAAA TATATCAGTGCCCGGTGTGA CATTATTAAACTGCACTTCAGC CAGGTAGGCGTTCCGTACAT GTGCAAAAAGGGCATCAAAT

and DNA sequencing. The resulting double mutant has lost spontaneously the pKOBEG plasmid and was called EDL933 ⌬stx throughout this study. Real-time RT-PCR and ELISA confirmed that this strain does not express stx1 and stx2 and does not synthesize Stx.

T84 cell cultures and infections The human colon adenocarcinoma cell line T84 was maintained in 50% DMEM with glutamax, 50% Ham’s F12, 10% FBS, 1% sodium pyruvate, 10 mM HEPES, 100 U/ml penicillin, and 100 ␮g/ml streptomycin. Cells (106/well) were plated on 6-well plates and cultured for 7–10 days at 37°C under 5% CO2; there was ⬃3 ⫻ 106 cells/well at confluence. Bacteria were added to the cells at a multiplicity of infection of 10 in complete medium without antibiotics in the presence or absence of purified Stx1 and Stx2. MG132 (10 ␮M), wortmannin (10 nM), LY294002 (10 ␮M), or the Akt inhibitor (10 ␮M) were added to cell cultures 30 min prior to the infection and were kept in the cocultures during the infection. At the end of the infection, cocultures were washed and RNA or proteins were extracted from fixed cells. The determination of kinase phosphorylation, NF-␬B activation, mRNA expression, and chemokine production was analyzed 2, 3, 6, and 24 h after the beginning of the infection, respectively.

mRNA analysis by real-time PCR Total RNA of T84 cells was isolated using TRIzol. Subsequently, 2 ␮g of RNA from each sample were reverse-transcribed using oligo(dT) primers and 5 U/␮l Superscript II reverse transcriptase. cDNA (1 ␮l) was amplified by the LightCycler FastStart DNA Master SYBR Green I Kit (Roche Diagnostics) containing 0.12 pmol/␮l of each human CCL20 and IL-8 primers (Table I) and 0.03 pmol/␮l ␤-actin primers (22) in a LightCycler apparatus (Roche Diagnostics). One PCR cycle consisted of the following: 94°C for 30 s, 58°C for 30 s, and 72°C for 45 s. The specificity was checked by analyzing the melting curves. Results were calculated using the comparative cycle threshold method in which the amount of target mRNA is normalized to the internal control ␤-actin. Results are expressed as relative mRNA expression compared with uninfected cells. Total bacterial RNA was purified with TRIzol and 1 ␮g of RNA from each sample was reverse-transcribed using random primers and 5 U/␮l Superscript II reverse transcriptase. Serial dilutions of cDNA were amplified in the LightCycler apparatus (Roche Diagnostics) using the LightCycler FastStart DNA Master SYBR Green I Kit (Roche) with the primers Estx1, Estx2, and EtufA (Table I). One PCR cycle consisted of the following: 94°C for 30 s, 58°C for 30 s, and 72°C for 45 s. The levels of stx1, stx2, and tufA mRNA (copy number per nanogram of cDNA) were quantified by noting the fluorescence crossing point of the samples on the corresponding standard curve and the results are presented as the ratios between the copy number of stx1 or stx2 mRNA and the copy number of tufA mRNA. Standard curves for stx1, stx2, and tufA genes were obtained by 1) PCR amplification of genomic DNA

Downloaded from http://www.jimmunol.org/ by guest on July 22, 2018

from the Shigella, Salmonella, or Escherichia genus (10, 11), numerous in vitro studies have evidenced that NF-␬B plays a key role in the induction of proinflammatory factors by EHEC-infected human intestinal epithelial cell lines (12, 13). EHEC factors, e.g., flagellin or proteins encoded by the locus of enterocyte effacement, have been shown to modulate NF-␬B activation (14). More particularly, some studies support the notion that Stx might stimulate the innate immune response (15, 16). Nonetheless, the experiments have been performed with Gb-3-expressing cell lines, and according to the duration of the stimulation and the Stx concentration, various results have been obtained (9). We thus hypothesized that Stx could modulate NF-␬B activation in human intestinal epithelial cells. We constructed and used to stimulate the cells, a stx1/stx2-deficient mutant in the O157:H7 EHEC strain EDL933. In this article, we provide evidence that EHEC-derived Stx decreases NF-␬B activation by inhibiting the PI3K-Akt signaling pathway. Consequently, the NF-␬B-dependent chemokine mRNA expression is inhibited by Stx. These results highlight that Stx is an unrecognized inhibitor of the epithelial cell innate immune response.

8169

8170

INHIBITION OF CHEMOKINE mRNA EXPRESSION BY Stx

from the EDL933 strain with the primers Sstx1, Sstx2, and StufA (Table I) and 0.25 U of Platinum TaqDNA polymerase, 2) PCR product purification with the Strataprep PCR Purification Kit (Stratagene), and 3) amplification in the LightCycler apparatus of serial dilution of purified PCR products with Estx1, Estx2, and EtufA primers.

EMSA T84 nuclear lysates were obtained using the NE-PER Nuclear and Cytoplasmic Extract Kit (Pierce) and protein concentration was measured with the protein assay kit (Bio-Rad). The following double-stranded oligonucleotide probe containing the NF-␬B-binding consensus sequence (italicized letters) was used: 5⬘-TCCAAGGGGACTTTCCATG-3⬘. Nuclear proteins (1 ␮g) were incubated for 30 min with 1 ng of poly(dI:dC) and 20 fmol of a dsDNA probe biotinylated with the Biotin 3⬘ End DNA Labeling Kit in a final volume of 20 ␮l of EMSA-binding buffer (10 mM Tris-HCl (pH 8), 50 mM NaCl, 0.5 mM EDTA, and 1 mM DTT); to check the specificity of the reaction, 2 pmol of an unlabeled dsDNA probe was added to the mixture. The samples were separated by 5% PAGE, transferred onto positive-charged nylon membrane by electroblotting, and oligonucleotides were UV cross-linked to the membrane. The presence of the biotin-labeled probes was detected using the Chemiluminescent Nucleic Acid Detection Module. Densitometry was performed with the Diversity Database 2.2.0 software (Bio-Rad).

The EZ-Detect Transcription Factor Kit for NF-␬B p50 was used to measure the level of translocated NF-␬B in 5 ␮g of T84 cell nuclear proteins according to the manufacturer’s instructions. Luminosity was detected in the MicroLumatPlus luminometer (EG&G Berthold Technologies) and analyzed with Winglow software (EG&G Berthold Technologies).

Determination of serine/threonine kinase phosphorylation The analysis of the phosphorylation/activation of MAPKs and of other kinases was performed using the Proteome Profiler for Human PhosphoMAPK Array Kit (R&D Systems) with 100 ␮g of total cellular proteins. The pixel density of each spot was analyzed with the Diversity Database 2.2.0 software (Bio-Rad).

Immunoblotting Whole T84 cell protein extracts were resolved by 10% SDS-PAGE and transferred onto nitrocellulose membrane. The membrane was blocked in PBS containing 5% nonfat dry milk and 0.1% Tween 20 and hybridized overnight at 4°C with a polyclonal Ab against human Akt (1/500; US Biological) or human phosphor-Ser473-Akt (1/500; US Biological). After washes, membrane was incubated with a HRP-conjugated goat anti-rabbit IgG Ab (1/5000) for 1 h at room temperature. Chemiluminescent detection was performed using the ECL Western Blotting Substrate (Pierce).

ylenediamine in Stable Peroxidase Substrate (Pierce). Absorbency was measured at 492 nm.

Statistical analysis Student’s t test was used to determine significant differences between the two groups. ANOVA with the Student-Newman-Keuls test was used to analyze significant differences among multiple test groups. A value of p ⫽ 0.05 was considered to be significant.

Immunofluorescence and confocal microscopy

Results

T84 cells were grown and infected on Lab-Tek slides (Nunc). Cells were fixed in methanol for 20 min at ⫺20°C, washed in PBS, and incubated for 1 h at room temperature in PBS containing 10% FBS, 1% BSA, and a goat serum (1/1000). After washes, cells were treated with an anti-NF-␬B (p65) rabbit polyclonal Ab (1/1000; Calbiochem) or with an anti-Stx2 mAb (1/ 5000) overnight at 4°C. Then, a goat anti-rabbit IgG DyLight 647-conjugated Ab (1/1000) or a goat anti-mouse IgG DyLight 547-conjugated Ab (1/2000) was used for 1 h at room temperature. After washes, cells were briefly exposed to 1 ␮g/ml 4⬘,6⬘-diamidino-2-phenylindole (DAPI), washed thoroughly with water, and mounted with a cover slide. Fluorescence was visualized using a Zeiss LSM 510 Meta confocal microscope.

Stx binds to Gb-3-negative intestinal epithelial cells

Determination of chemokine concentration Cell culture supernatants were harvested 18 h after the end of the 6-h infection. CCL20 and IL-8 concentrations were then measured using the Duo Set ELISA Kit (R&D Systems) according to the manufacturer’s protocol.

Stx2 concentration analysis Maxisorp plates (Nunc) were coated overnight with a mAb against Stx1 or Stx2 (1/500). After a blocking step in PBS/0.05% Tween 20/5 mg/ml BSA, plates were incubated with serial dilutions of bacterial culture supernatants or of various concentrations of purified Stx1 or Stx2. A rabbit serum against Stx1 or Stx2 (1/5,000) developed in our laboratory and a HRPconjugated goat anti-rabbit IgG (1/10,000) were then successively added to the plates. Colorimetric detection was performed using 0.2 mg/ml o-phen-

EDL933 were grown for 3 h in complete cell culture medium in the presence or absence of T84 cells. The growth of EDL933 was similar with or without cells (data not shown). We did not find a significant difference in stx1 and stx2 gene expression in EHEC cultured alone or in the presence of epithelial cells (Fig. 1A). However, we noted that in both conditions the stx2 gene was more expressed than the stx1 gene. To examine whether Stx is bound to these Gb-3-deficient epithelial cells, toxin concentrations were measured in the culture supernatants. Stx1 and Stx2 were synthesized by E. coli EDL933 in the T84 cell culture medium (Fig. 1B). Nonetheless, the production of Stx2 was ⬃10-fold higher than that of Stx1. When the bacteria were cocultured with the cells, Stx1 and Stx2 were not detected in the supernatants. Stx1 and Stx2 were not detected in EDL933 ⌬stx supernatants (data not shown). We confirmed by confocal microscopy that EHEC-derived Stx was fixed by T84 cells. Stx2 was clearly immunodetected in the cytoplasm of EDL933-infected cells and was not present in cells uninfected or infected with the stx mutant strain (Fig. 1C). Together, these results suggest that Stx synthesized by EDL933 is fixed and internalized by the cells.

Downloaded from http://www.jimmunol.org/ by guest on July 22, 2018

ELISA-based NF-␬B assay

FIGURE 1. Stx uptake by T84 cells. The EHEC strain EDL933 (107 bacteria) was grown alone (f) or in the presence of 106 T84 cells (䡺) for 3 h. A, Expression of stx genes. Bacteria were collected and stx1 and stx2 mRNA were analyzed by quantitative PCR. The mean ⫾ SEM of three experiments are shown. B, Analysis of Stx concentrations. Culture supernatants were harvested and filtered (0.2 ␮m); Stx1 and Stx2 concentrations were then determined by ELISA. A and B, Each bar represents the mean ⫾ SEM of four experiments performed in duplicate. ⴱⴱⴱ, p ⬍ 0.001 vs bacteria alone. C, Cellular localization of Stx2. T84 cells were cultured, infected 6 h with EDL933 or EDL933 ⌬stx, and fixed on Lab-Tek slides. Stx2 was immunodetected using an anti-Stx2A mAb (green) and the nuclear outline was defined by DAPI staining (red). Merged images are shown (original magnification, ⫻630). Ctrl, Control.

The Journal of Immunology

FIGURE 3. Effects of EDL933 and EDL933 ⌬stx on CCL20 and IL-8 expression in T84 cells. A, mRNA analysis. Epithelial cells were treated with MG132 (䡺) or were left untreated (f) and infected with EDL933 (EDL) or EDL933 ⌬stx (EDL ⌬stx) for 6 h. Total RNA was extracted and CCL20 and IL-8 mRNA levels were analyzed by real-time PCR. Ctrl, Uninfected cells. Values are expressed as the mean ⫾ SEM of four experiments performed in duplicate. ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01 compared with cells treated with MG132; §, p ⬍ 0.05; §§, p ⬍ 0.01 vs EDL933 ⌬stxinfected T84 cells. B, Chemokine production. After a 6-h infection, cells were washed and incubated for 18 h in a fresh medium containing antibiotics. CCL20 and IL-8 concentrations were determined by ELISA in the culture supernatants. Ctrl, Uninfected cells. Values are expressed as the mean ⫾ SEM of five experiments. ⴱ, p ⬍ 0.05 vs control cells.

Inhibition of chemokine mRNA expression by Stx

Increased NF-␬B activation in response to EDL933 ⌬stx To examine whether EHEC-derived Stx plays a role in NF-␬B activation in epithelial cells, we sought to stimulate T84 cells with EDL933 and EDL933 ⌬stx. According to Dahan et al. (13), we analyzed NF-␬B activation 3 h after EHEC infection. First, NF-␬B activation was assessed by EMSA; as shown in Fig. 2A, we observed a slight increase of NF-␬B activation upon stimulation with wild-type (WT) EHEC in comparison to uninfected cells. However, NF-␬B was markedly activated when the cells were stimulated with the stx mutant strain; this induction was completely inhibited when the NF-␬B inhibitor MG132 was added to the cocultures. To ensure that NF-␬B was more activated in cells infected with the strain that does not synthesize Stx, we repeated our experiments using a specific ELISA. The level of activated NF-␬B in T84 cells infected with EDL933 ⌬stx was significantly enhanced by 2.8 ⫾ 0.8 and 1.8 ⫾ 0.2-fold compared with control cells or with cells infected with EDL933, respectively (Fig. 2B). NF-␬B activation was completely inhibited in EDL933 ⌬stx-infected cells treated with MG132 (0.94 ⫻ 105 Luminosity Unit; mean of three independent experiments). Finally, these results were confirmed by immunofluorescence and confocal microscopy (Fig. 2C) and for each condition the data from 50 cells were compiled. NF-␬B was detected in the cytoplasm of all uninfected epithelial cells. When cells were infected with WT or ⌬stx EHEC, the nuclear translocation of NF-␬B was observed in ⬃10 and 40% of the cells, respectively. Taken together, these results demonstrate that Stx produced by EHEC minimize NF-␬B activation.

It has been previously described that transcription of the genes encoding IL-8 (10) and CCL20 (23) requires NF-␬B. As shown above, EHEC-derived Stx inhibits NF-␬B activation in T84 cells. Therefore, we investigated IL-8 and CCL20 mRNA expression in response to EDL933 and EDL933 ⌬stx. Basically, similar results were obtained for both chemokines (Fig. 3A). The basal expression of theses genes was up-regulated by ⬃7-fold under EDL933 infection. When the cells were infected with EDL933 ⌬stx, the levels of CCL20 and IL-8 mRNA increased 2.2- and 3.6-fold when compared with the EDL933-infected cells, respectively. A total and significant inhibition of both gene transcription was observed when cells infected with EDL933 ⌬stx were treated with MG132; this inhibition was not complete when the cells were infected with the WT strain. Moreover, CCL20 and IL-8 mRNA expression were decreased by 2.3 ⫾ 0.1- and 1.7 ⫾ 0.3-fold when 10 ng/ml Stx1 plus 100 ng/ml Stx2 were added in the cocultures of T84 cells and EDL933 ⌬stx when compared with the mutant strain alone (n ⫽ 3; data not shown). Additionally, the same Stx mixture had no effect on chemokine gene expression in T84 cells (data not shown). To confirm our results, we measured CCL20 and IL-8 concentrations in supernatants of cells infected or not with EDL933 or with the mutant strain (Fig. 3B). The synthesis of both chemokines significantly increased when cells were infected with EDL933 ⌬stx and not with the WT strain. In summary, we demonstrate that NF-␬B inhibition by Stx decreases chemokine mRNA expression and chemokine production. Phosphorylated kinase profile of EHEC-infected T84 cells To gain further insight into the mechanism by which Stx inhibits NF-␬B activation, we determined the phosphorylation of signaling

Downloaded from http://www.jimmunol.org/ by guest on July 22, 2018

FIGURE 2. Analysis of NF-␬B activation in response to EHEC. T84 cells were infected or not (Ctrl) for 3 h with the strain EDL933 (EDL) or the isogenic stx-deficient strain (EDL ⌬stx), in the presence or absence of MG132 (MG; 10 ␮M). A, EMSA. Nuclear proteins were extracted and analyzed by EMSA. Equal amounts of protein (1 ␮g) were loaded on the gel. UP, Unlabeled probe. Similar results were obtained in four independent experiments. Densit., Densitometric acquisition of each band (intensity per square millimeter). B, Immunodetection of activated NF-␬B in 10 ␮g of nuclear protein extracts. Each bar represents the mean ⫾ SEM of five experiments performed in duplicate. ⴱ, p ⬍ 0.05 compared with uninfected cells and with cells infected with EDL933. C, Localization of NF-␬B by confocal microscopy. T84 cells were cultured, infected, and fixed on LabTek slides. NF-␬B was immunodetected using an anti-p65 polyclonal Ab (green), and the nuclear outline was defined by DAPI staining (red). Merged images are shown (original magnification, ⫻630) and overlay is presented in yellow (arrow). Same results have been obtained in two independent experiments.

8171

8172

INHIBITION OF CHEMOKINE mRNA EXPRESSION BY Stx

Table II. Human phospho-MAPK array-derived data for phosphorylation of serine/threonine kinasea

Investigation of the effect of Stx on the PI3K/Akt/NF-␬B pathway

Phosphorylation Levels (pixel density) Kinases JNK1 MSK2 ERK1 ERK2 Akt1 Akt2 Akt3 RSK1 GSK-3␣␤

Control 0 EDL933 17 EDL933 18 ⌬stx

0 57 47

0 215 109

22 101 29 125 45 0 91 172 53

41 0 70

87 83 138

230 152 287

a Proteins were extracted from T84 cells cultured for 2 h with EDL933 or EDL933 ⌬stx. Control, Uninfected cells. Representative data of two independent experiments are shown.

FIGURE 4. Implication of the PI3K/Akt signaling pathway in NF-␬Bdependent chemokine induction. T84 cells were treated or not with wortmannin (W; 10 nM) or Akt inhibitor (A; 10 ␮M) 30 min before infection with EDL933 (EDL) or EDL933 ⌬stx (EDL ⌬stx). A, Akt activation. Total proteins extracted from infected cells for 3 h were analyzed by Western blot using anti-phospho-Ser473-Akt or anti-Akt (⬃55 kDa for each). Equal amounts of protein (20 ␮g) were loaded on the gel. B, NF-␬B activation. Nuclear proteins were extracted and analyzed by EMSA. C, mRNA expression. After 6 h, total RNA was extracted and CCL20 (f) and IL-8 (䡺) mRNA levels were analyzed by real-time PCR. Data are the mean ⫾ SEM of three experiments. ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01; §§, p ⬍ 0.01 vs T84 cells infected with EDL933 ⌬stx.

Discussion The effect of EHEC-derived Stx on human enterocytes has not been studied in detail. This is an important issue given that intestinal epithelial cells are the first in contact with the bacteria, and that these cells may play an important role in the development of the inflammatory response (24). In this study, we show that Stx produced by EHEC O157:H7 inhibits the inducible expression of chemokine mRNAs, namely, CCL20 and IL-8, in Gb-3-negative human enterocytes by suppressing the PI3K/Akt/NF-␬B signaling pathway. Therefore, we establish herein that Stx is not only an inhibitor of translation, but also an indirect suppressor of gene transcription. Stx is the EHEC virulence factor responsible for the hemolytic syndromes. Stx induces apoptosis and/or necrosis of Gb-3-presenting cells, i.e., renal microvascular endothelial cells and several epithelial cell lines, by altering ribosomal functions. Paradoxically, this general blockade of mRNA translation is associated with the inducible release of various mediators of the inflammation (15, 16). Several data support the concept that the Stx-dependent upregulation of proinflammatory genes in Gb3-positive epithelial cell lines occurs through the ribotoxic stress response since Stx, and other compounds possessing an N-glycosidase activity, induces cytokine release (25). Nonetheless, an alternative route for Stx transport exists in Gb-3-negative T84 cells (8), which does not lead to protein synthesis inhibition and cell death (7, 8). These data, obtained using purified Stx, are in agreement with our finding showing that Stx produced in the coculture T84/EDL933 is internalized by epithelial cells. Therefore, it is likely that Stx synthesized by EHEC in vivo in the vicinity of the colonic epithelium after infection/colonization might be bound by Gb-3-negative enterocytes. However, it has been recently reported that Gb-3-expressing Paneth cells of human intestinal mucosa bind Stx (26). Paneth cells are secretory cells that produce defensins to fight bacterial infection. Nonetheless, it has been never described that these cells synthesize chemokines, essential mediators of EHEC pathogenesis. Moreover, binding of Stx1 and Stx2 to Paneth cells of normal intestinal tissue was observed only in 58 and 32% of individuals, respectively

Downloaded from http://www.jimmunol.org/ by guest on July 22, 2018

serine/threonine kinases in response to WT and ⌬stx strains. Among 19 signaling kinases tested, those modulated by EHEC infection are presented in Table II. We found that JNK1 and MSK2 proteins were similarly phosphorylated by EDL933 and by EDL933 ⌬stx when compared with uninfected cells. However, ERK1 and 2 were more phosphorylated when cells were infected with EDL933 than with EDL933 ⌬stx. In contrast, the basal phosphorylation of Akt proteins, RSK1, and GSK-3␣␤ observed in control cells was decreased in cells infected with EDL933 and enhanced in cells infected with the mutant strain. Finally, it should be noted that proteins from the p38 family, heat shock protein 27 and p70S6 kinase, were not phosphorylated after 2 h of infection with both strains (data not shown). To conclude, we demonstrate that the phosphorylation of the kinase Akt, RSK1, and GSK-3␣␤ were inhibited by EHEC-derived Stx in T84 cells.

We observed that Akt and NF-␬B were concomitantly activated by EDL933 ⌬stx. Since the activation of NF-␬B by the PI3K/Akt transduction pathway has been reported, we analyzed the effect of EHEC-derived Stx on the PI3K/NF-␬B signaling pathway. In Fig. 4A, we confirmed that Akt phosphorylation on Ser473 was more induced by EDL933 ⌬stx than by the WT strain; the use of the PI3K inhibitor wortmannin on EDL933 ⌬stx-infected cells yielded a decrease of Akt phosphorylation. In contrast, the total amount of unactivated Akt was not modified by EDL933 or EDL933 ⌬stx infection (Fig. 4A). Moreover, in T84 cells infected with the Stx-deficient strain, NF-␬B activation was completely inhibited by wortmannin (PI3K inhibitor) or by an Akt inhibitor (Fig. 4B). Concomitantly, EDL933 ⌬stx-induced CCL20 and IL-8 mRNA expression was significantly inhibited by both pharmacological inhibitors (Fig. 4C). In an additional set of experiments, we used the PI3K inhibitor LY294002 to confirm our data. The chemokine gene expression was as follows: for CCL20, EDL933 ⌬stx, 16 ⫾ 2.5; for EDL933 ⌬stx plus LY294002, 6.1 ⫾ 0.2; for IL-8, EDL933 ⌬stx, 22 ⫾ 3.1; and for EDL933 ⌬stx plus LY294002, 9.5 ⫾ 4.9 (fold increase per uninfected cells, n ⫽ 3). Chemokine mRNA expression in cells stimulated with the WT strain were not affected by the inhibitors (data not shown).

The Journal of Immunology

ability of Akt to regulate NF-␬B activity occurs through the phosphorylation/activation of the I␬B kinase, which in turn phosphorylates I␬B and allows the release of activated NF-␬B (40), and/or by stimulating transactivation of the p65 subunit by an I␬B kinasedependent pathway (41). We now present new evidence that the PI3K/Akt/NF-␬B pathway is an unrecognized signal transduction induced by EHEC in human enterocytes but inhibited by Stx. The phosphorylation/inactivation of GSK-3␣␤, which is driven by Akt (42), was also completely inhibited by EDL933 and increased above control after infection with EDL933 ⌬stx, supporting the likelihood that Stx inhibits the signal PI3K/Akt. We propose that, in the absence of Stx, activation of the PI3K/Akt pathway is a major event leading to NF-␬B-dependent gene transcription since chemokine mRNA expression was completely inhibited in EDL933 ⌬stx-infected T84 cells treated with MG132. Interestingly, we also observed that RSK1 is more activated by EDL933 ⌬stx than by the WT strain; because RSK1 phosphorylates I␬B and contributes to the persistent activation of NF-␬B (43), we suggest that this pathway could also lead to increased NF-␬B activation by the stx mutant. Recently, it has been reported that Stx favors EHEC adherence to human epithelial cells by increasing surface expression of nucleolin (44), a eukaryotic receptor for bacterial intimin (45). Consequently, a Stx-deficient EHEC strain poorly colonizes the mouse intestine compared to the parental strain (44). Together, these findings and our data showing that Stx subverts the inflammatory response of human enterocytes underline an essential role for Stx in the initial step of the colonization of the intestinal mucosa.

Acknowledgments The plasmid pKO3 was provided by G. M. Church (Harvard Medical School, Boston, MA). We thank C. Tissandier, A. Garrivier, and A. Durand for their technical assistance.

Disclosures The authors have no financial conflict of interest.

References 1. Paton, J. C., and A. W. Paton. 1998. Pathogenesis and diagnosis of Shiga toxinproducing Escherichia coli infections. Clin. Microbiol. Rev. 11: 450 – 479. 2. Tarr, P. I., C. A. Gordon, and W. L. Chandler. 2005. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 365: 1073–1086. 3. 2005. Outbreak of E. coli 0157:H7 infections associated with a brand of beefburgers in France. Euro. Surveill. 10: E051103.1. 4. Maki, D. G. 2006. Don’t eat the spinach: controlling foodborne infectious disease. N. Engl. J. Med. 355: 1952–1955. 5. Herold, S., H. Karch, and H. Schmidt. 2004. Shiga toxin-encoding bacteriophages-genomes in motion. Int. J. Med. Microbiol. 294: 115–121. 6. Bjork, S., M. E. Breimer, G. C. Hansson, K. A. Karlsson, and H. Leffler. 1987. Structures of blood group glycosphingolipids of human small intestine: a relation between the expression of fucolipids of epithelial cells and the ABO, Le and Se phenotype of the donor. J. Biol. Chem. 262: 6758 – 6765. 7. Jacewicz, M. S., D. W. Acheson, M. Mobassaleh, A. Donohue-Rolfe, K. A. Balasubramanian, and G. T. Keusch. 1995. Maturational regulation of globotriaosylceramide, the Shiga-like toxin 1 receptor, in cultured human gut epithelial cells. J. Clin. Invest. 96: 1328 –1335. 8. Schuller, S., G. Frankel, and A. D. Phillips. 2004. Interaction of Shiga toxin from Escherichia coli with human intestinal epithelial cell lines and explants: Stx2 induces epithelial damage in organ culture. Cell. Microbiol. 6: 289 –301. 9. Gobert, A. P., K. T. Wilson, and C. Martin. 2005. Cellular responses to attaching and effacing bacteria: activation and implication of the innate immune system. Arch. Immunol. Ther. Exp. 53: 234 –244. 10. Elewaut, D., J. A. DiDonato, J. M. Kim, F. Truong, L. Eckmann, and M. F. Kagnoff. 1999. NF-␬B is a central regulator of the intestinal epithelial cell innate immune response induced by infection with enteroinvasive bacteria. J. Immunol. 163: 1457–1466. 11. Girardin, S. E., R. Tournebize, M. Mavris, A. L. Page, X. Li, G. R. Stark, J. Bertin, P. S. DiStefano, M. Yaniv, P. J. Sansonetti, and D. J. Philpott. 2001. CARD4/Nod1 mediates NF-␬B and JNK activation by invasive Shigella flexneri. EMBO Rep. 2: 736 –742. 12. Berin, M. C., A. Darfeuille-Michaud, L. J. Egan, Y. Miyamoto, and M. F. Kagnoff. 2002. Role of EHEC O157:H7 virulence factors in the activation of

Downloaded from http://www.jimmunol.org/ by guest on July 22, 2018

(26). Therefore, although Paneth cells may exert immunological functions during EHEC infection, we propose that Stx behaves on the innate immune response of Gb-3-negative enterocytes, and thus have an important role in EHEC pathogenesis. We first focused our investigations on NF-␬B, the principal transcription factor activated during the inflammatory response. Our results demonstrated that EDL933 weakly induces DNA-binding activity of NF-␬B in T84 cells; a stronger activation of this transcription factor was observed in cells stimulated with the isogenic stx-deficient strain. Consequently, the NF-␬B-dependent inducible transcription of both CCL20 and IL-8 was higher in T84 cells infected with the stx-deficient mutant than with the WT strain. Therefore, it appears that the Gb-3 status of the cells is essential for the initiation of the signal transduction induced by Stx. In Gb-3positive cells, Stx induces a MAPK-dependent induction of proinflammatory genes (15, 25), whereas Stx inhibits NF-␬B signaling in Gb-3-negative enterocytes. Nonetheless, the mechanism by which Stx signals in human enterocytes remains to be elucidated. Because Stx was found within the cells, a surface-binding interaction or an intracellular signaling may be responsible for this cellular event. The activation of NF-␬B in T84 cells in response to the EHEC strain EDL931 was previously established by Dahan et al. (13). Moreover, it has been also described that NF-␬B is poorly and transiently activated in HeLa cells infected for 3 h with EDL933 or with an O26:H⫺ STEC strain (27); in this report, the authors also show that cells stimulated with a mutant lacking EspB exhibit increased DNA-binding activity of NF-␬B, suggesting an inhibition of the cellular response by this translocator and effector protein encoded by the locus of enterocyte effacement. Recently, the inhibition of IFN-␥-induced STAT-1 phosphorylation/activation in T84 cells by EHEC has been also established (28). Together, these reports suggest that EHEC have elaborated multiple strategies to decrease the activation of transcription factors implicated in the expression of proinflammatory genes and thus to escape the host innate defenses. Multiple signaling pathways may converge to activate NF-␬B in epithelial cells stimulated with pathogenic E. coli (29, 30). The MAPK p38, ERK1/2, and JNK are stimulated by EHEC in Caco-2 (12) and T84 cells (13). Nonetheless, although these transduction factors play a significant role in regulating intestinal epithelial cell IL-8 production, they are not involved in NF-␬B activation (12, 13). We did not find p38 activation in our experiments. We propose that the phosphorylation of p38 was over at this time point, because p38 is transiently activated before both other MAPK (13, 31). Although purified Stx is recognized to induce JNK phosphorylation in Gb-3-expressing Hct-8 cells (25), we showed that the protein JNK was activated at the same level by EDL933 and by the stx-deficient strain, suggesting that Stx is not involved in this pathway in Gb-3-negative cells. Interestingly, activation of the MAPK ERK1/2 was 2-fold higher in cells infected with EDL933 in comparison to cells infected with EDL933 ⌬stx. Inversely, the phosphorylation of Akt was completely inhibited following infection with EDL933 and was increased above control when the stx mutant strain was used. In this context, we can hypothesize that a close correlation exists between ERK1/2 and Akt. Actually, the inhibition of Akt phosphorylation by ERK1/2 (32, 33) as well as the decreased ERK1/2 activation by a PI3K/Akt-dependent pathway (34, 35) have been described. The activation of the PI3K/Akt pathway has been evidenced in response to different bacterial species (36 –39) and plays a major function in cell invasion (37, 39). Additionally, the PI3K/Akt-dependent activation of NF-␬B has also been evidenced in rat intestinal epithelial cells in response to the commensal Gram-negative Bacteroides vulgatus (36). The

8173

8174

13.

14.

15.

16.

17.

18.

19.

21.

22.

23.

24.

25.

26.

27.

28.

29. Savkovic, S. D., A. Ramaswamy, A. Koutsouris, and G. Hecht. 2001. EPECactivated ERK1/2 participate in inflammatory response but not tight junction barrier disruption. Am. J. Physiol. 281: G890 –G898. 30. Savkovic, S. D., A. Koutsouris, and G. Hecht. 2003. PKC ␨ participates in activation of inflammatory response induced by enteropathogenic E. coli. Am. J. Physiol. 285: C512–C521. 31. Hennig, B., W. Lei, X. Arzuaga, D. D. Ghosh, V. Saraswathi, and M. Toborek. 2006. Linoleic acid induces proinflammatory events in vascular endothelial cells via activation of PI3K/Akt and ERK1/2 signaling. J. Nutr. Biochem. 17: 766 –772. 32. Sinha, D., S. Bannergee, J. H. Schwartz, W. Lieberthal, and J. S. Levine. 2004. Inhibition of ligand-independent ERK1/2 activity in kidney proximal tubular cells deprived of soluble survival factors up-regulates Akt and prevents apoptosis. J. Biol. Chem. 279: 10962–10972. 33. Zhuang, S., Y. Yan, R. A. Daubert, J. Han, and R. Schnellmann. 2007. ERK promotes hydrogen peroxide-induced apoptosis through caspase-3 activation and inhibition of Akt in renal epithelial cells. Am. J. Physiol. Renal Physiol. 292: F440 –F447. 34. Laprise, P., M. J. Langlois, M. J. Boucher, C. Jobin, and N. Rivard. 2004. Downregulation of MEK/ERK signaling by E-cadherin-dependent PI3K/Akt pathway in differentiating intestinal epithelial cells. J. Cell Physiol. 199: 32–39. 35. Huang, F. C., Q. Li, and B. J. Cherayil. 2005. A phosphatidyl-inositol-3-kinasedependent anti-inflammatory pathway activated by Salmonella in epithelial cells. FEMS Microb. Lett. 243: 265–270. 36. Haller, D., M. P. Russo, R. B. Sartor, and C. Jobin. 2002. IKK␤ and phosphatidylinositol 3-kinase/Akt participate in non-pathogenic Gram-negative enteric bacteria-induced RelA phosphorylation and NF-␬B activation in both primary and intestinal epithelial cell lines. J. Biol. Chem. 277: 38168 –38178. 37. Coombes, B. K., and J. B. Mahony. 2002. Identification of MEK- and phosphoinositide 3-kinase-dependent signalling as essential events during Chlamydia pneumoniae invasion of HEp2 cells. Cell. Microbiol. 4: 447– 460. 38. Li, X., J. C. Tupper, D. D. Bannerman, R. K. Winn, C. J. Rhodes, and J. M. Harlan. 2003. Phosphoinositide 3 kinase mediates Toll-like receptor 4-induced activation of NF-␬B in endothelial cells. Infect. Immun. 71: 4414 – 4420. 39. Kierbel, A., A. Gassama-Diagne, K. Mostov, and J. N. Engel. 2005. The phosphoinositol-3-kinase-protein kinase B/Akt pathway is critical for Pseudomonas aeruginosa strain PAK internalization. Mol. Biol. Cell. 16: 2577–2585. 40. Ozes, O. N., L. D. Mayo, J. A. Gustin, S. R. Pfeffer, L. M. Pfeffer, and D. B. Donner. 1999. NF-␬B activation by tumour necrosis factor requires the Akt serine-threonine kinase. Nature 401: 82– 85. 41. Madrid, L. V., C. Y. Wang, D. C. Guttridge, A. J. Schottelius, A. S. Baldwin, Jr., and M. W. Mayo. 2000. Akt suppresses apoptosis by stimulating the transactivation potential of the RelA/p65 subunit of NF-␬B. Mol. Cell. Biol. 20: 1626 –1638. 42. van Weeren, P. C., K. M. de Bruyn, A. M. de Vries-Smits, J. van Lint, and B. M. Burgering. 1998. Essential role for protein kinase B (PKB) in insulininduced glycogen synthase kinase 3 inactivation: characterization of dominantnegative mutant of PKB. J. Biol. Chem. 273: 13150 –13156. 43. Ghoda, L., X. Lin, and W. C. Greene. 1997. The 90-kDa ribosomal S6 kinase (pp90rsk) phosphorylates the N-terminal regulatory domain of I␬B␣ and stimulates its degradation in vitro. J. Biol. Chem. 272: 21281–21288. 44. Robinson, C. M., J. F. Sinclair, M. J. Smith, and A. D. O’Brien. 2006. Shiga toxin of enterohemorrhagic Escherichia coli type O157:H7 promotes intestinal colonization. Proc. Natl. Acad. Sci. USA 103: 9667–9672. 45. Sinclair, J. F., and A. D. O’Brien. 2002. Cell surface-localized nucleolin is a eukaryotic receptor for the adhesin intimin-␥ of enterohemorrhagic Escherichia coli O157:H7. J. Biol. Chem. 277: 2876 –2885.

Downloaded from http://www.jimmunol.org/ by guest on July 22, 2018

20.

intestinal epithelial cell NF-␬B and MAP kinase pathways and the upregulated expression of interleukin 8. Cell. Microbiol. 4: 635– 648. Dahan, S., V. Busuttil, V. Imbert, J. F. Peyron, P. Rampal, and D. Czerucka. 2002. Enterohemorrhagic Escherichia coli infection induces interleukin-8 production via activation of mitogen-activated protein kinases and the transcription factors NF-␬B and AP-1 in T84 cells. Infect. Immun. 70: 2304 –2310. Rogers, T. J., A. W. Paton, S. R. McColl, and J. C. Paton. 2003. Enhanced CXC chemokine responses of human colonic epithelial cells to locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli. Infect. Immun. 71: 5623–5632. Thorpe, C. M., B. P. Hurley, L. L. Lincicome, M. S. Jacewicz, G. T. Keusch, and D. W. Acheson. 1999. Shiga toxins stimulate secretion of interleukin-8 from intestinal epithelial cells. Infect. Immun. 67: 5985–5993. Yamasaki, C., Y. Natori, X. T. Zeng, M. Ohmura, S. Yamasaki, Y. Takeda, and Y. Natori. 1999. Induction of cytokines in a human colon epithelial cell line by Shiga toxin 1 (Stx1) and Stx2 but not by non-toxic mutant Stx1 which lacks N-glycosidase activity. FEBS Lett. 442: 231–234. Hu, Y., L. Qiao, S. Wang, S. B. Rong, E. J. Meuillet, M. Berggren, A. Gallegos, G. Powis, and A. P. Kozikowski. 2000. 3-(Hydroxymethyl)-bearing phosphatidylinositol ether lipid analogues and carbonate surrogates block PI3-K, Akt, and cancer cell growth. J. Med. Chem. 43: 3045–3051. Perna, N. T., G. Plunkett III, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, et al. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409: 529 –533. Link, A. J., D. Phillips, and G. M. Church. 1997. Methods for generating precise deletions and insertions in the genome of wild-type Escherichia coli: application to open reading frame characterization. J. Bacteriol. 179: 6228 – 6237. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640 – 6645. Chaveroche, M. K., J. M. Ghigo, and C. d’Enfert. 2000. A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans. Nucleic Acids Res. 28: E97. Gobert, A. P., Y. Cheng, J. Y. Wang, J. L. Boucher, R. K. Iyer, S. D. Cederbaum, R. A. Casero, Jr., J. C. Newton, and K. T. Wilson. 2002. Helicobacter pylori induces macrophage apoptosis by activation of arginase II. J. Immunol. 168: 4692– 4700. Sugita, S., T. Kohno, K. Yamamoto, Y. Imaizumi, H. Nakajima, T. Ishimaru, and T. Matsuyama. 2002. Induction of macrophage-inflammatory protein-3 ␣ gene expression by TNF-dependent NF-␬B activation. J. Immunol. 168: 5621–5628. Hurley, B. P., C. M. Thorpe, and D. W. Acheson. 2001. Shiga toxin translocation across intestinal epithelial cells is enhanced by neutrophil transmigration. Infect. Immun. 69: 6148 – 6155. Smith, W. E., A. V. Kane, S. T. Campbell, D. W. Acheson, B. H. Cochran, and C. M. Thorpe. 2003. Shiga toxin 1 triggers a ribotoxic stress response leading to p38 and JNK activation and induction of apoptosis in intestinal epithelial cells. Infect. Immun. 71: 1497–1504. Schuller, S., R. Heuschkel, F. Torrente, J. B. Kaper, and A. D. Phillips. 2007. Shiga toxin binding in normal and inflamed human intestinal mucosa. Microbes Infect. 9: 35–39. Hauf, N., and T. Chakraborty. 2003. Suppression of NF-␬B activation and proinflammatory cytokine expression by Shiga toxin-producing Escherichia coli. J. Immunol. 170: 2074 –2082. Jandu, N., P. J. Ceponis, S. Kato, J. D. Riff, D. M. McKay, and P. M. Sherman. 2006. Conditioned medium from enterohemorrhagic Escherichia coli-infected T84 cells inhibits signal transducer and activator of transcription 1 activation by ␥ interferon. Infect. Immun. 74: 1809 –1818.

INHIBITION OF CHEMOKINE mRNA EXPRESSION BY Stx