Genotypic Characterization of Enterotoxigenic Escherichia coli Strains

Genotypic Characterization of Enterotoxigenic Escherichia coli Strains

Genotypic Characterization of Enterotoxigenic Escherichia coli Strains Causing Traveler’s Diarrhea Fulton P. Rivera,a,b Anicia M. Medina,a Edelweiss A...

113KB Sizes 0 Downloads 0 Views

Recommend Documents

Characterization of Multidrug Resistant Escherichia coli Isolates
Nov 18, 2016 - [7] Bergeron, C.R., Prussing, C., Boerlin, P., Daignault, D., Dutil, L., Reid-Smith, R.J., Zhanel,. G.G.

Escherichia coli K12 Strains for Use in the Identification - Microbiology
immunity to it (V. de Lorenzo & A. P. Pugsley, unpublished observations). All of these strains, like those listed in ...

Extensive Gene Diversity in Septicemic Escherichia coli Strains
Extraintestinal pathogenic Escherichia coli strains (ExPEC) are the cause of a diverse spectrum of invasive infections i

Characterization of two mutations in the Escherichia coli galE gene
Sep 6, 1983 - Institut fur Genetik der Universitat zu Koin, Weyertal 121, D-5000 Koin. 41, FRG ..... located > 15 bp ups

Escherichia coli - CDC
tions in Guatemala or remaining at least 14 days in Antigua in Guatemala, or in Cuernavaca, Mexico, were included in the

Escherichia coli - ernährungs umschau
Ursprünglich trugen die Bakterien den. Namen „Bacterium coli commune“. Der. Gattungsname Bacterium deutet auf die m

Phosphotransferase SystemSugars by Escherichia coli - Journal of
Aug 17, 1982 - ROY A. BLACK,t* ANN C. HOBSON,f AND JULIUS ADLER. Department ofBiochemistry and Department of Genetics, C

The Replication of DNA in Escherichia Coli
Jan 28, 2009 - graduated with aPh.D in liberal acts from the University of Chicago. California Institute of Technology a

Ether-lipid membrane engineering of Escherichia coli
A mio padre, mia madre e mia sorella per avermi sempre sostenuto, incoraggiato e creduto in me dall'inizio alla fine. Al

Veterinary significance of verocytotoxin-producing Escherichia coli
Chapman, P.A., Wright, D.J., Norman, P., Fox, J. & Crick, E. 1993 Cattle as a possible source of .... Moxley, R.A. & Fra

Genotypic Characterization of Enterotoxigenic Escherichia coli Strains Causing Traveler’s Diarrhea Fulton P. Rivera,a,b Anicia M. Medina,a Edelweiss Aldasoro,c Anna Sangil,c,d Joaquim Gascon,c Theresa J. Ochoa,a,e Jordi Vila,c Joaquim Ruizc Instituto de Medicina Tropical Alexander von Humboldt, Universidad Peruana Cayetano Heredia, Lima, Perua; Laboratorio de Fisiopatogenia, Departamento de Fisiología, Facultad de Medicina, Universidad de Buenos Aires, Buenos Aires, Argentinab; Barcelona Centre for International Health Research (CRESIB-Hospital Clínic-Universitat de Barcelona), Barcelona, Spainc; Unitat de Malalties Infeccioses, Medicina Interna, Hospital Universitari Mutua Terrassa, Terrassa, Spaind; Center for Infectious Diseases, University of Texas School of Public Health, Houston, Texas, USAe

E

nterotoxigenic Escherichia coli (ETEC) is by far the most common pathogen causing traveler’s diarrhea (TD) worldwide, being responsible for up to 30 to 60% of all TD cases (1, 2). ETEC adheres to and colonizes the human intestinal mucosa thanks to specific antigenic fimbriae called colonization factors (CFs) (2, 3). Following CF-mediated mucosal adhesion, ETEC elaborates heatlabile toxin (LT) and/or heat-stable toxin (ST), causing secretion of water and electrolytes (4). Inactivated enterotoxins and some CFs have been used as vaccine candidates in clinical studies (5, 6, 7), but none of them has yielded results in clinical trials sufficiently robust to foster completion of clinical development. Moreover, the great variability of ETEC CFs requires the determination of prevalent CF types in different geographic locations and population types (2, 7). An alternative approach for vaccine development would be to focus on ETEC antigens other than enterotoxins. Other virulence factors (VFs) have been identified from the prototype strain ETEC H10407 (O78:H11/LTI-STh-STp/CFA/I). These “nonclassical” VFs include adhesins (Tia, TibA), a cytoplasmic protein with GTPase activity (LeoA), an autotransporter (EatA), and an enteroaggregative E. coli heat-stable enterotoxin (EAST1) (8). Additionally, the E. coli common pilus (ECP), common to both commensal and pathogenic E. coli, may be present, but its role in ETEC pathogenesis is not yet established (9). To our knowledge, these genes have not been systematically evaluated in epidemiological studies in ETEC strains associated with TD. In this study, we characterized VFs of ETEC causing TD in Spanish travelers abroad. Fifty-two ETEC isolates causing TD obtained between January 2004 and August 2011 as part of a passive TD surveillance study in Barcelona, Spain, were grown from frozen stock. From these, clinical data were recovered in 30 cases. TD was defined as the occurrence between 12 h after arrival in, and 5 days after departure from, the country visited; of three or more episodes of watery diarrhea within a 24-h period with or without other symptoms; or as the occurrence of unformed stools accompanied by one of the following: abdominal cramps, tenesmus, vomiting, nausea, fever, chills, or prostration. The presence of E. coli and other bacterial enteropathogens was determined by conventional methods, while PCR was used to detect enteroaggregative E. coli (EAEC), enteropathogenic E. coli (EPEC), and ETEC (10). The presence of classical (LT, STh, STp, CFA/I, CS1, CS2, CS3, CS4, CS5, CS6, CS7,

February 2013 Volume 51 Number 2

CS8, CS12, CS14, CS17, CS18, CS19, CS20, and CS21) and nonclassical (Tia, LeoA, TibA, EatA, EAST1, and ECP) VFs was determined by PCR as previously described (11, 12, 13, 14, 15, 16) (Table 1). Chi-square or Fisher exact tests were used for comparisons between groups as appropriate. ETEC strains were isolated from patients mostly returning from Africa (15/30, 50%), Asia/Pacific (10/30, 33%), and Central America (4/30, 13%). The median duration of travel was 21 days (range, 7 to 300 days). ST-positive (ETEC-ST) strains (23/52, 44%, including STh and STp) were the most frequent, followed by strains with both LT and ST (ETEC-LT-ST) (14/52, 27%) and strains positive for only LT (ETEC-LT) (15/52, 29%) (Table 2). STh (estA⫹) was the toxin type most frequently identified. This study employs travelers returning with diarrhea. Since most ETEC infections are brief and self-limited, returning travelers will be biased toward more severe cases and/or cases of longer duration. This may actually make the analysis more significant since it may reveal the factors common among the more severe traveler’s pathogens, but validation in another study would be required for verification. The most common CFs were CS21 (58%), CS6 (27%), and CS3 (23%) (Table 2). There were no differences between the geographical area of travel and the CF types identified, with CS21 (Longus) being the most common CF in all areas. The presence of multiple CFs in a given isolate was frequent, these CFs being frequently associated with CS21. The STh⫹ CS21 genotype (with or without other CFs) was the most prevalent among all strains (44%, 23/52). The ECP was detected in 81% of all strains. Meanwhile, the most common nonclassical VFs were EAST1 (65%), autotransporter EatA (48%), and adhesin Tia (21%) (Table 2). TD owing to infection with ETEC is a considerable problem for travelers in high-risk regions. In several studies, the most preva-

Received 26 September 2012 Returned for modification 16 November 2012 Accepted 27 November 2012 Published ahead of print 5 December 2012 Address correspondence to Joaquim Ruiz, [email protected] Copyright © 2013, American Society for Microbiology. All Rights Reserved. doi:10.1128/JCM.02572-12

Journal of Clinical Microbiology

p. 633– 635

jcm.asm.org

633

Downloaded from http://jcm.asm.org/ on August 12, 2018 by guest

This study aims to characterize the presence of virulence factors of enterotoxigenic Escherichia coli (ETEC) causing traveler’s diarrhea. Among 52 ETEC isolates, the most common toxin type was STh, and the most frequent colonization factors (CFs) were CS21, CS6, and CS3. On the other hand, the nonclassical virulence factors EAST1 and EatA were frequently present.

Rivera et al.

TABLE 1 Sequences of primers used in this study Primer sequence Size (bp)

STp STh CFA/I CS1 CS2 CS3 CS4 CS5 CS6 CS7 CS8 CS12 CS14 CS17-19 CS17 CS18 CS20 CS21 Tia TibA LeoA EatA EcpA EAST1

166 120 497 410 358 300 242 558 165 203 166 263 162 324 348 131 114 617 535 655 574 1943 483 111

a

Forward (5=–3=)

Reverse (5=–3=)

Reference

TCTTTCCCCTCTTTTAGTCAG TTCACCTTTCCCTCAGGATG ACTATTGGTGCAATGGCTCTGAC GAGAAGACCATTAGCGTTACGG ACTGTAACTGCTAGCGTTGATCC CCCACTCTAACCAAAGAACTGG ATTGATATTTTGCAAGCTGATGG CAACCGTATCAGGTTCTGTTTTG AAATGTATCCCAGGTAACGGTCT TGCTCCCGTTACTAAAAATAC ATCCGGATTATCAAGCTCCA GCGAATAACAATGATGCAAG TTTGCAACCGACATCTACCA TAAACTTGATCTTCTGCAAGC Paired with CS17-19 forward AACCAGCACCGGTGATAAAG AGGTATCCAAATCCGCACTG TCATGAGCCTGCTGGAAGTTATCA GCTTCAGTTGTGATGCAGAC CACGACAAATCAAACGTACC CGTTTATGGACGATGAGTTG ATGTGCTTTGGCAGGTTAAT TGAAAAAAAAGGTTCTGGCAATAGC CCATCAACACAGTATATCCGA

ACAGGCAGGATTACAACAAAG CTATTCATGCTTTCAGGACCA CAGGATCCCAAAGTCATTACAAG CCCTGATATTGACCAGCTGTTAG TGCTTCCTGCATTAATAACGAGT CGTATTTCCAGCATTTTTATCCA GTCACATCTGCGGTTGATAGAGT CAAATGTTACCGGAGCTACAAAG TGTTGATTAGGCGTAACCTCTGT TAGATGTCGTATCACTACGT GAAGATGTTATTGCACCACCAA CCTGACTGGTTTACAAGATA CCGGATGTAGTTGCTCCAAT GCATGAATCGTAAGCTGTTG TCAGGCGCAGTTCCTTGTGTG CTGGCTGGCCATTTAAGGTA CATCAGCCAGCACATAGGAA TCCGGCTACCTAAAGTAATTGAGT CAGCATCCAGATAGCGATAG CTTCCGCCGTAGAGATACAT TCTGCCAGCTCAGTAACAAC ATATCCAGTCAGCACCCACT CGCTGATGATGGAGAAAGTGAA GGTCGCGAGTGACGGCTTTGT

11 13 15 15 15 15 15 15 15 12 14 12 14 12 12 14 14 13 12 12 12 12 9 16

Number of base pairs of the amplified product.

TABLE 2 Virulence factors in traveler’s diarrhea-associated ETEC isolates (n ⫽ 52) Virulence factora

n (%)d

Classicalb LT STp STh LT-STh STh-STp CFA/I CS1 CS2 CS3 CS4 CS5 CS6 CS17 CS19 CS20 CS21 At least one colonization factor ⱖ2 colonization factorsc

15 (29) 2 (4) 17 (33) 14 (27) 4 (8) 6 (12) 7 (13) 4 (8) 12 (23) 2 (4) 1 (2) 14 (27) 3 (6) 1 (2) 1 (2) 30 (58) 36 (69) 28 (54)

Nonclassical E. coli common pilus Enteroaggregative heat-stable toxin 1 (EAST1) Autotransporter EatA Adhesin Tia Dispersin transporter (aatA) GTP-binding protein (LeoA) Adhesin TibA

42 (81) 34 (65) 25 (48) 11 (21) 4 (8) 3 (6) 1 (2)

a

All virulence factors were detected by PCR. Colonization factors CS7, CS8, CS12, CS14, and CS18 were not detected. c Sixteen strains showed two CFs, including four with CFA/I and CS21, three with CS3 and CS21, and nine with CS6 and CS21; eight strains showed three CFs, including one with CFA/I-CS6-CS21, four with S1-CS3-CS21, two with CS2-CS3-CS21, and one with CS4-CS6-CS21; three strains showed four CFs, including one with CFA/I-CS4-CS6CS21, one with CS1-CS2-CS3-CS21, and one with CS1-CS3-CS6-CS21; and one strain showed five CFs, CS2-CS3-CS5-CS6-CS21. d Number (percentage) of isolates with indicated factor. b

634

jcm.asm.org

lent CFs associated with the occurrence of diarrhea worldwide are CFA/I, CS1, CS2, CS3, and CS6; more recently, CS8, CS14, and CS21 have been detected with relatively high frequencies (6). In contrast with some studies performed in developing countries, where CFA/I has been described as the most prevalent CF, accounting for up to 21% of samples (2), in our study, CFA/I was present only in 12% of isolates. Thus, the prevalence of CF antigens may be related to geographical origin. Among nonclassical VFs, EAST1 (65%, 34/52) and EatA protein (48%, 25/52) were frequently detected in our strains. The presence of EAST1, structurally related to STI peptides, which also leads to increases in cyclic GMP (cGMP) (17), in multiple strains may suggest functional redundancy of toxins with the capacity to provoke elevated levels of cGMP (8). EatA acts as a serine protease, belonging to the SPATE family of proteins (serine protease autotransporters of Enterobacteriaceae). Although a precise function or substrate for EatA is not clear, initial studies in ileal loops suggested that EatA could contribute to accelerated virulence of eatA⫹ strains (18). Despite our searching for the CFs most commonly described in the literature, 31% of all ETEC strains did not possess any of the tested CFs. In a prior study, Blackburn et al. reported that 58% of ETEC strains were positive for the Escherichia coli common pilus (ECP), a percentage even higher than that of the most prevalent CFs and independent of the presence of CFs, suggesting an important role for ECP in the biology of ETEC, particularly in CF-negative strains and in human infections (9). In our study, the ECP gene (ecpA) was identified in 81% (42/52) of the present isolates. In recent years, a variety of different structures (other than colonization factors) encoded either on plasmids or in the chromosome of ETEC have been identified as putative adhesins. Among these adhesins, Tia is an outer membrane protein that interacts with host cell surface proteoglycans (19) and by itself is sufficient

Journal of Clinical Microbiology

Downloaded from http://jcm.asm.org/ on August 12, 2018 by guest

Virulence factor

a

Traveler’s Diarrhea-Associated ETEC

to promote adherence and epithelial cell invasion when cloned into laboratory strains of E. coli. The success of an ETEC vaccine targeting travelers from industrialized countries to developing countries will depend on a combination of maximally antigenic vaccine preparations and regimens for their delivery which will produce optimal immune responses. While vaccine development to prevent diarrheal illness due to ETEC is feasible, extensive efforts are needed to identify new conserved antigenic targets. Additional studies will be needed to determine the utility of these antigens as well as other autotransporters in ETEC vaccines.

8. 9. 10. 11.

ACKNOWLEDGMENTS

REFERENCES 1. Gascon J, Vila J, Valls ME, Ruiz L, Vidal J, Corachán M, Prats G, Jimenez de Anta MT. 1993. Etiology of traveller’s diarrhea in Spanish travellers to developing countries. Eur. J. Epidemiol. 9:217–223. 2. Qadri F, Svennerholm AM, Faruque AS, Sack RB. 2005. Enterotoxigenic Escherichia coli in developing countries: epidemiology, microbiology, clinical features, treatment, and prevention. Clin. Microbiol. Rev. 18:465– 483. 3. Gaastra W, Svennerholm AM. 1996. Colonization factors of human enterotoxigenic Escherichia coli (ETEC). Trends Microbiol. 4:444 – 452. 4. Kaper JB, Nataro JP, Mobley HL. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2:123–140. 5. Boedeker EC. 2005. Vaccines for enterotoxigenic Escherichia coli: current status. Curr. Opin. Gastroenterol. 21:15–19. 6. Svennerholm AM, Tobias J. 2008. Vaccines against enterotoxigenic Escherichia coli. Expert Rev. Vaccines 7:795– 804. 7. Walker RI, Steele D, Aguado T, Ad Hoc ETEC Technical Expert

February 2013 Volume 51 Number 2

12.

13.

14.

15.

16. 17.

18. 19.

jcm.asm.org 635

Downloaded from http://jcm.asm.org/ on August 12, 2018 by guest

A.M.M. attended a 3-month training course through the CRESIB-UPCH collaborative agreement; training was partially funded by Consejo Nacional de Ciencia, Tecnología e Innovación Tecnológica (CONCYTEC, FONDECYT) in Peru. This work was partially funded by the Agencia Española de Cooperación Internacional para el Desarrollo (AECID), Spain, Programa de Cooperación Interuniversitaria e Investigación Científica con Iberoamérica (D/019499/08, D/024648/09, D/030509/10, and A1/035720/11); Departament d’Universitats, Recerca i Societat de la Informació de la Generalitat de Catalunya, Spain 2009SGR685 (J.R.) and 2009SGR385 (J.G. and E.A.); and National Institutes of Health, Public Health Service award 1K01TW007405 (T.J.O.); J.R. has a fellowship from program I3 of the ISCIII (grant no. CES11/012) There is no conflict of interest for any of the authors.

Committee. 2007. Analysis of strategies to successfully vaccinate infants in developing countries against enterotoxigenic E. coli (ETEC) disease. Vaccine 25:2545–2566. Fleckenstein JM, Hardwidge PR, Munson GP, Rasko DA, Sommerfelt H, Steinsland H. 2010. Molecular mechanisms of enterotoxigenic Escherichia coli infection. Microbes Infect. 12:89 –98. Blackburn D, Husband A, Saldaña Z, Nada RA, Klena J, Qadri F, Girón JA. 2009. Distribution of the Escherichia coli common pilus among diverse strains of human enterotoxigenic E. coli. J. Clin. Microbiol. 47:1781–1784. Vargas M, Gascón J, Gallardo F, Jimenez De Anta MT, Vila J. 1998. Prevalence of diarrheagenic Escherichia coli strains detected by PCR in patients with travelers’ diarrhea. Clin. Microbiol. Infect. 4:682– 688. Bölin I, Wiklund G, Qadri F, Torres O, Bourgeois AL, Savarino S, Svennerholm AM. 2006. Enterotoxigenic Escherichia coli with STh and STp genotypes is associated with diarrhea both in children in areas of endemicity and in travelers. J. Clin. Microbiol. 44:3872–3877. Del Canto F, Valenzuela P, Cantero L, Bronstein J, Blanco JE, Blanco J, Prado V, Levine M, Nataro J, Sommerfelt H, Vidal R. 2011. Distribution of classical and nonclassical virulence genes in enterotoxigenic Escherichia coli isolates from Chilean children and tRNA gene screening for putative insertion sites for genomic islands. J. Clin. Microbiol. 49: 3198 –3203. Rodas C, Iniguez V, Qadri F, Wiklund G, Svennerholm AM, Sjöling A. 2009. Development of multiplex PCR assays for detection of enterotoxigenic Escherichia coli colonization factors and toxins. J. Clin. Microbiol. 47:1218 –1220. Sjöling A, Wiklund G, Savarino SJ, Cohen DI, Svennerholm AM. 2007. Comparative analyses of phenotypic and genotypic methods for detection of enterotoxigenic Escherichia coli toxins and colonization factors. J. Clin. Microbiol. 45:3295–3301. Vidal RM, Valenzuela P, Baker K, Lagos R, Esparza M, Livio S, Farfán M, Nataro JP, Levine MM, Prado V. 2009. Characterization of the most prevalent colonization factor antigens present in Chilean clinical enterotoxigenic Escherichia coli strains using a new multiplex polymerase chain reaction. Diagn. Microbiol. Infect. Dis. 65:217–223. Yamamoto T, Echeverria P. 1996. Detection of the enteroaggregative Escherichia coli heat-stable enterotoxin 1 gene sequences in enterotoxigenic E. coli strains pathogenic for humans. Infect. Immun. 64:1441–1445. Savarino SJ, Fasano A, Watson J, Martin BM, Levine MM, Guandalini S, Guerry P. 1993. Enteroaggregative Escherichia coli heat-stable enterotoxin 1 represents another subfamily of E. coli heat-stable toxin. Proc. Natl. Acad. Sci. U. S. A. 90:3093–3097. Patel SK, Dotson J, Allen KP, Fleckenstein JM. 2004. Identification and molecular characterization of EatA, an autotransporter protein of enterotoxigenic Escherichia coli. Infect. Immun. 72:1786 –1794. Fleckenstein JM, Holland JT, Hasty DL. 2002. Interaction of an outer membrane protein of enterotoxigenic Escherichia coli with cell surface heparan sulfate proteoglycans. Infect. Immun. 70:1530 –1537.