SALSA MS-MLPA probemix ME001-C2 Tumour suppressor mix 1

SALSA MS-MLPA probemix ME001-C2 Tumour suppressor mix 1

MRC-Holland ® Description version 17; 07 December 2016 MLPA SALSA MS-MLPA probemix ME001-C2 Tumour suppressor mix 1 Lot C2-0815 and C2-0412. Compar...

503KB Sizes 0 Downloads 5 Views

MRC-Holland ®

Description version 17; 07 December 2016

MLPA

SALSA MS-MLPA probemix ME001-C2 Tumour suppressor mix 1 Lot C2-0815 and C2-0412. Compared to previous lot C1-0808, new control fragments have been added (QDX2). This SALSA® MLPA® probemix is for basic research! This probemix enables you to detect aberrant methylation of CpG islands upstream of genes for which an altered methylation status in one or more types of tumours has been reported in literature. In case interesting results are obtained by users, it is possible to develop methylation probemixes specific for a certain tumour in collaboration with MRC-Holland. Interpretation of results obtained with this product can be complicated. MRC-Holland cannot provide assistance with data interpretation. Aberrant methylation of CpG-islands has been shown to be associated with transcriptional inactivation of tumour suppressor genes in a wide spectrum of human cancers. CpG islands are located in or near the promoter region or other regulatory regions of approximately 50% of human genes. This ME001-C2 MS-MLPA probemix contains 26 MS-MLPA probes which detect the methylation status of promoter regions of 24 different tumour suppressor genes. These tumour suppressor genes are frequently silenced by methylation in tumours, but are unmethylated in blood-derived DNA of healthy individuals. In addition, 15 reference probes are included which are not affected by HhaI digestion. Besides detecting aberrant methylation, all 41 probes will give information on copy number changes in the analysed sample. The MLPA reaction requires as little as 20 ng of human DNA and can be used on a variety of DNA samples, including those derived from paraffin-embedded tissues. The MS-MLPA probes in this ME001-C2 probemix detect sequences in promoter regions of tumour suppressor genes that are unmethylated in most blood-derived DNA samples. Upon digestion, the peak signal obtained in unmethylated samples will be very small or absent. In contrast, when tested on in vitro methylated human DNA, these probes do generate a signal. We have no data showing that methylation detected by a particular probe indeed influences the corresponding mRNA level. This SALSA® MS-MLPA® probemix can be used to detect aberrant methylation of one or more sequences of the tumour suppressor genes. Methylation levels can be different for different tissues. If possible, use identically treated test and reference samples (same tissue type and extraction method). This SALSA® MSMLPA® probemix can be used to detect deletions/duplications of one or more sequences in the above mentioned chromosomal regions in a DNA sample. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak height of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak height, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. Finally, note that most defects in this gene are expected to be small (point) mutations which will not be detected by this SALSA® MS-MLPA® test. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. This SALSA MLPA probemix is not CE/FDA registered for use in diagnostic procedures. Purchase of this product includes a limited license for research purposes. The use of this SALSA® MS-MLPA® probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). The MS-MLPA method for the detection of both copy numbers and methylation changes was described in Nucleic Acid Research 33, e128 by Nygren et al. 2005. More information Website : www.mlpa.com E-mail : [email protected] (information & technical questions); [email protected] (for orders) Mail : MRC-Holland bv; Willem Schoutenstraat 1, 1057 DL Amsterdam, the Netherlands SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 1 of 10

MRC-Holland ®

Description version 17; 07 December 2016

MLPA

Related SALSA® MLPA® probemixes  ME002 Tumour suppressor mix 2: Can be used for several genes to confirm the results of ME001.  ME011 Mismatch Repair genes: Contains MS-MLPA probes for promoter regions of MLH1, MSH2, MSH6, PMS2, MSH3 and MLH3 genes.  ME012 MGMT-IDH1-IDH2: Contains six MS-MLPA probes for MGMT gene promoter and four mutationspecific probes for IDH1 R132H&C and IDH2 R172K&M point mutations.  ME024 9p21 CDKN2A/2B region: Contains copy number and MS-MLPA probes for CDKN2A/2B gene region, as well as copy number probes for MIR31, MTAP and PAX5 genes.  More methylation-specific probemixes are available, please enquire. References of SALSA® MS-MLPA® probemix ME001 Tumour suppressor mix 1  Mariano et al., 2016. Evaluation of a subset of tumor suppressor gene for copy number and epigenitic changes in pleomorphic adenoma and carcinoma ex-pleomorphic adenoma carcinogenesis. Oral Surg Oral Med Oral Pathol Oral Radiol. 122:322-31.  Gurioli et al., 2016. Methylation pattern analysis in prostate cancer tissue: identification of biomarkers using an MS-MLPA approach. J Transl Med. 14:249.  Costales et al., 2016. Gene Methylation Profiling in Sinonasal Adenocarcinoma and Squamous Cell Carcinoma. Otolaryngol Head Neck Surg. PMID: 27301901 [Epub ahead of print].  La Rosa et al., 2016. TP53 alterations in pancreatic acinar cell carcinoma: new insights into the molecular pathology of this rare cancer. Virchows Arch. 468:289-96.  Shakeri et al., 2016. DNA methylation assessment as a prognostic factor in invasive breast cancer using methylation-specific multiplex ligation dependent probe amplification. EXCLI J. 15:11-20.  Moelans et al., 2015. Methylation biomarkers for pleomorphic lobular breast cancer - a short report. Cell Oncol (Dordr). 38:397-405.  Magnani et al., 2015. Molecular Features and Methylation Status in Early Onset (≤40 Years) Colorectal Cancer: A Population Based, Case-Control Study. Gastroenterol Res Pract. 2015:132190.  Imperatori et al., 2015. Durable recurrence-free survival after pneumonectomy for late lung metastasis from rectal cancer: case report with genetic and epigenetic analyses. BMC Cancer. 15:567.  Noorlag et al., 2014. Promoter hypermethylation using 24-gene array in early head and neck cancer: better outcome in oral than in oropharyngeal cancer. Epigenetics. 9:1220-7.  Moelans et al., 2014. Clonal intratumor heterogeneity of promoter hypermethylation in breast cancer by MS-MLPA. Mod Pathol. 27:869-74.  Furlan et al., 2013 Diagnostic utility of MS-MLPA in DNA methylation profiling of adenocarcinomas and neuroendocrine carcinomas of the colon-rectum. Virchows Arch. 462:47-56  Joosse et al., 2012. Prediction of BRCA2-association in hereditary breast carcinomas using array-CGH. Breast Cancer Res Treat. 132:379-89.  Schwarzenbach et al., 2011. Genomic profiling of cell-free DNA in blood and bone marrow of prostate cancer patients. J Cancer Res Clin Oncol. 137:811-9.  Marzese et al., 2011. Aberrant DNA methylation of cancer-related genes in giant breast fibroadenoma: a case report. J Med Case Reports. 5:516.  Janssen et al., 2010. Methylation patterns in CD34 positive chronic myeloid leukemia blast crisis cells. Haematologica. 95:1036-7.  Buyru et al., 2009. Methylation profiles in breast cancer. Cancer Invest. 27:307-12.  Henken et al., 2007. Sequential gene promoter methylation during HPV-induced cervical carcinogenesis. Br J Cancer. 97:1457-64. Note: Above is a selection of references for this probemix; PubMed and Google Scholar provide more references and information on the use of the ME001 probemix. Methylation-specific MLPA Please note that each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of 10-50 different sequences in one simple reaction. MLPA probes for methylation SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 2 of 10

MRC-Holland ®

Description version 17; 07 December 2016

MLPA

quantification are similar to normal MLPA probes, except that the sequence detected by the MS-MLPA probe contains the sequence recognised by the methylation-sensitive restriction enzyme HhaI. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridization. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridization reaction is incubated with the methylation-sensitive HhaI endonuclease while simultaneously, the hybridised probes are ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be exponentially amplified by PCR and hence will not generate a signal when analysed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemi-methylated probe-sample DNA hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. The MS-MLPA technique should always be internally validated before use in your laboratory. Results of MSMLPA are highly dependent on the HhaI enzyme used. HhaI enzymes that are resistant to heat inactivation are NOT compatible with the MS-MLPA technique and will give aberrant results. These include, but may not be limited to, Thermo Fisher Scientific enzymes HhaI, ANZA 59 HhaI, and FastDigest HhaI. We recommend using Promega’s HhaI enzyme (R6441) as this is the only restriction enzyme that has been validated for use with MS-MLPA by MRC-Holland. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product can not be used with an alternative protocol in which the genomic DNA is first digested with HhaI, followed by MLPA reactions on both digested and undigested genomic DNA. Data analysis The ME001-C2 Tumour suppressor mix 1 probemix contains 41 MLPA probes with amplification products between 136 and 484 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at 64-70-76-82 nt, three DNA denaturation control fragments (D-fragments) at 88-92-96 nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. The analysis of MS-MLPA probemixes consists of two parts: 1) determining copy numbers by comparing different undigested samples, and 2) determining methylation patterns by comparing each undigested sample to its digested counterpart (MS-MLPA probemixes only). The second part is unique for MS-MLPA probemixes and serves to semi-quantify the percentage of methylation within a given sample. 1) Copy number analysis

- Selection of reference probes First select suitable reference probes for copy number detection. These are probes detecting relatively quiet regions in the particular type of tumour studied. The reference probes selected will therefore depend on the application. Probes that are suitable to use for reference in many types of tumour are indicated in Table 1.

- Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but “intra-normalised” data are used (relative peak heights). The data generated in the undigested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe’s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison.

- Inter-sample normalisation (comparison with reference samples) The final probe ratio, or ploidy status, of each probe in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the undigested test sample by b) the average Normalisation Constant of that probe obtained on the undigested reference samples.

SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 3 of 10

MRC-Holland ®

Description version 17; 07 December 2016

MLPA

2) Methylation analysis

- Selection of reference probes Use the reference probes for methylation as marked in Table 1. All reference probes used for methylation analysis do not contain a HhaI site.

- Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but “intra-normalised” data are used (relative peak heights). The data generated in the digested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe’s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison.

- Methylation analysis (comparison with reference samples) The methylation status of each MS-MLPA probe* in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the digested test sample by b) the Normalisation Constant of each MS-MLPA probe obtained on the corresponding undigested sample. Multiplying this value by 100 gives an estimation of the percentage of methylation. Aberrant methylation can then be identified by comparing the methylation status of one or more MS-MLPA probes in the sample in question to that obtained on reference samples. *Note: An MS-MLPA probe targets a single specific HhaI site in a CpG island; if methylation is absent for a particular CpG-site, this does not necessarily mean that the whole CpG island is unmethylated! Data normalisation should be performed within one experiment. Only samples purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blotting, long range PCR, qPCR, FISH. Warning: MLPA analysis on tumour samples provides information on the average situation in the cells from which the DNA sample was purified. Gains or losses of genomic regions or genes may not be detected if the percentage of tumour cells is low. Furthermore, there is always a possibility that one or more reference probes do show a copy number alteration in a sample. Normal copy number variation in healthy individuals is described in the database of genomic variants: http://dgv.tcag.ca/dgv/app/home. When in doubt, users should always verify the latest updates of the database and scientific literature when interpreting their findings. Note that Coffalyser, the MLPA analysis tool developed at MRC-Holland, can be downloaded free of charge from our website www.mlpa.com. This probemix was developed at MRC-Holland. Info/remarks/suggestions for improvement: [email protected]

SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 4 of 10

MRC-Holland ®

MLPA

Description version 17; 07 December 2016

Table 1. SALSA MS-MLPA ME001-C2 Tumour suppressor mix 1 probemix Length (nt)

SALSA MLPA probe

HhaI site

% expected Chromosomal signal position reduction

Reference probe for Copy number

Methylation

64-70-76-82 Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA 88-92-96 D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 136 CREM probe 00981-L00566 10p11.21 Yes Yes 100% 142 TIMP3 probe 02255-L03752 + 22q12.3 Yes 100% 148 APC probe 01905-L01968 + 5q22.2 Yes 154 PARK2 probe 03366-L02750 6q26 Yes Yes 161 CDKN2A probe 01524-L01744 + 100% 9p21.3 100% 167 ‡ MLH1 probe 01686-L01266 + 3p22.2 Yes 175 TNFRSF1A probe 00554-L13516 12p13.31 Yes Yes 100% 184 ATM probe 04044-L03849 + 11q22.3 Yes 193 RARB probe 04040-L01698 + 100% 3p24.2 Yes 202 MLH3 probe 01245-L00793 14q24.3 Yes Yes 85% 211 CDKN2B probe 00607-L00591 + 9p21.3 100% 220 « HIC1 probe 03804-L00949 + 17p13.3 Yes 229 PAH probe 02334-L01820 12q23.2 Yes Yes 100% 238 « CHFR probe 03813-L03753 + 12q24.33 Yes 100% 246 BRCA1 probe 05162-L04543 + 17q21.31 Yes 256 BCL2 probe 00587-L00382 18q21.33 Yes Yes 100% 265 CASP8 probe 02761-L02210 + 2q33.1 Yes 100% 274 « CDKN1B probe 07949-L07730 + 12p13.1 Yes 281 « TSC2 probe 01832-L01397 16p13.3 Yes Yes 100% 292 KLLN probe 02203-L08261 + 10q23.31 Yes 301 BRCA2 probe 04042-L03755 + 100% 13q13.1 Yes 310 CDK6 probe 03184-L02523 7q21.2 Yes Yes 100% 319 CD44 probe 03817-L01731 + 11p13 Yes 100% 328 RASSF1 probe 02248-L01734 + 3p21.31 Yes 337 CDH1 probe 02416-L01862 16q22.1 Yes Yes 100% 346 DAPK1 probe 01677-L01257 + 9q21.33 Yes 100% 353 ∫ VHL probe 03810-L01211 + 3p25.3 Yes 364 ° CELF2-region probe 01234-L00781 10p14 Yes Yes 373 ESR1 probe 02202-L01700 + 100% 6q25.1 Yes 100% 382 RASSF1 probe 03807-L02159 + 3p21.31 Yes 390 KLK3 probe 00713-L00108 19q13.33 Yes Yes 100% 400 « TP73 probe 04050-L01263 + 1p36.32 Yes 409 FHIT probe 02201-L01699 + 100% 3p14.2 Yes 418 BRCA2 probe 01617-L01199 13q13.1 Yes Yes 100% 427 ˅ CADM1 probe 03819-L03848 + 11q23.3 Yes 95% 436 CDH13 probe 07946-L07727 + 16q23.3 Yes 444 CD27 probe 00678-L00124 12p13.31 Yes Yes 100% 454 GSTP1 probe 01638-L01176 + 11q13.2 100% 463 « MLH1 probe 02260-L01747 + 3p22.2 Yes 475 CTNNB1 probe 03984-L03251 3p22.1 Yes Yes 484 CASR probe 02683-L02148 3q21.1 Yes Yes « This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. ‡ Target sequence of this probe contains SNP rs104894994 (C/T) in the GCGC site, 6 nt right from the ligation site. This validated SNP with an allele frequency of 0.068%, when T-allele present, will inhibit the HhaI restriction, resulting in a false-positive methylation signal. ∫ Target sequence of this probe contains SNP rs3087462 (C/T) in the GCGC site, 3 nt right from the ligation site. This validated SNP with an allele frequency of 2.8%, when T-allele present, will inhibit the HhaI restriction, resulting in a false-positive methylation signal. SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 5 of 10

MRC-Holland ®

MLPA

Description version 17; 07 December 2016 ° Probe renamed (was LOC254312).

˅ Probe renamed (was IGSF4). Note: a non-specific peak is present at ~121 nt. This peak does not correspond to an MLPA probe.

Table 2. ME001 probes arranged according to chromosomal location Length SALSA MLPA (nt) probe

Gene

400 ¤ «

04050-L01263

TP73

265

02761-L02210

CASP8

353 ∫ ¤

03810-L01211

VHL

193 ¤

04040-L01698

RARB

463 + «

02260-L01747

MLH1

167 + ‡

01686-L01266

MLH1

475

03984-L03251

CTNNB1

382

03807-L02159

RASSF1

328

02248-L01734

RASSF1

409

02201-L01699

FHIT

484

02683-L02148

CASR

148

01905-L01968

APC

373 ¤

02202-L01700

ESR1

154

03366-L02750

PARK2

Ligation site NM_005427.4; 12-13; 29790 nt before ATG NM_001080124.1; 100 nt before exon 3 NM_000551.3; 134-135; 80 nt before ATG NM_000965.4; 174 nt before exon 1 NM_000249.3; 184 nt before exon 1, reverse; 382 nt before ATG NM_000249.3; 186-187; 12 nt before ATG NM_001904.3; 351-352 NM_170714.1; 53-52, reverse; 79 nt before ATG NM_170714.1; 9 nt before exon 1; 141 nt before ATG NM_002012.2; 65 nt after exon 1 NM_000388.3; 2137-2138 NM_000038.5; 71 nt before exon 2 NM_001122742.1; 536-537; 163 nt after ATG NM_004562.2; 990-991

MV location (hg18) 01-003.558980 02-201.830872 03-010.158427 03-025.444565 03-037.009623 03-037.010001 03-041.241067

CGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTATTC GGCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACT

03-050.353349

CAGTCCCTGCACCCAGGTTTCCATTGCGCGGCTCTCCTCAGCTCCTTCCCGCCGC

03-061.211919 03-123.485227 05-112.101356 06-152.170884 06-162.126768

03184-L02523

CDK6

161 ¤ »

01524-L01744

CDKN2A

211 ٨

00607-L00591

CDKN2B

346

01677-L01257

DAPK1

364 °

01234-L00781

CELF2region

136

00981-L00566

CREM

NM_181571.1; 68-690

292 ¤

02203-L08261

KLLN

319 ¤

03817-L01731

CD44

454 ¤

01638-L01176

GSTP1

NM_000852.3; 153-154

11-067.107775

184 ¤

04044-L03849

ATM

NM_000051.3; 300-301

11-107.599045

CADM1

NM_014333.3; 175 nt before exon 1; 305 nt before ATG

11-114.880586

07-092.085392

CGCGGGTCTGGGTTTCCACGCGCGTCAGGTCATCACCCCGGAGCCCAGTGGG CCAGTGCCTGTAACAAGTGCCCAGATGACTTCTGGTCCAATGAGAACCACACCTCCTGCATTGCCAAGGA CAGCTGTGTAATCCGCTGGATGCGGACCAGGGCGCTCCCCATTCCCGTCGGGAGCCCGC CGCCCGCCGTGTACAACTACCCCGAGGGCGCCGCCTACGAGTTCAACGCCGCGGC CGTTCACGACCCTCAACTTGGCTACTCCCTGCCTTGTGTGGGTAAGTCTAGCATGTTTTCTCTCCAT GCGTGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCA

09-021.985277

CAGAGGGGAAGAGGAAAGAGGAAGAAGCGCTCAGATGCTCCGCGGCTGTCGTGAAGGTTAAAACCGAAAATAAAAAT

09-021.998809

CTGCGACAGCTCCTGGAAGCCGGCGCGGATCCCAACGGAGTCAACCGTTTCGGGAGG

09-089.303076

CGCGAGGATCTGGAGCGAACTGCTGCGCCTCGGTGGGCCGCTCCCTTCCCTCCCT

10-011.017024 10-035.517226

NM_001126049.1; 10-089.612349 806-805 reverse NM_001001391.1; 11-035.117390 418-419; 17 nt before ATG

SALSA MLPA probemix ME001 Tumour suppressor mix 1

CTGCTGAGGTGATCTGGCGCAGAGCGGAGGAGGTGCTTGGCGCTTCTCAGGCTCCTCCTCT

GTCCACAGGGCGGGCCCCGACTTCAGCGCCTCCCCCAGGATCCAGA

310

03819-L03848

CGCCCGCGAAGGGGACGCAGCGAAACCGGGGCCCGCGCCAGGCCAGCCGGGA CTTTCCAATAAAGCATGTCCAGCGCTCGGGCTTTAGTTTGCACGTCCATGAATTGTCTGCCACA GCGAAGACTACGGAGGTCGACTCGGGAGCGCGCACGCAGCTCCGCCCCGCGTCCGACC CCGCCGGCTTGTGCGCTCGCTGCCTGCCTCTCTGGCTGTCTGCTTTTGCAGGGCTGCT

03-050.353299

NM_001145306.1; 1244-1245 NM_058195.3; 829 nt before exon 1; 989 nt before ATG NM_078487.2; 470-471; 110 nt after ATG NM_004938.2; 256 nt after exon 1; 714 nt before ATG NR_015413.1; 968-967 reverse

427 ¤

(partial) sequence with HhaI site

CAATTGCCATTTTTTCCTGACATTCACTGTGGAAATTTGGTGCACGACACTGTTAGGGGAGATCTGT GCTCCTCCACCAGGTGCTACAATTGTACAGTACGCAGCACAATCAGCTGATGGCACACAGCAGT CACCGGAGCGGGCGCAGGAGAGGCCTGCGGGGTGCGTCCCACTCACAGGGAT CTCCTTTCGCCCGCGCCCTCCGTTCGCTCCGGACACCATGGACAAGTTTTGGTGG CGAAGAGCGGCCGGCGCCGTGACTCAGCACTGGGGCGGAGCGGGGCGGGACC GGAGGGAGGAGGCGAGAGGAGTCGGGATCTGCGCTGCAGCCACCGCCGCGGTTGATACTACTTT CCTGGAGCCCGAGTCCTTGCACGCCAGGCGCCCGGGAGAACACTTTTTCCTTGATCCGGGGAAAGC

Page 6 of 10

MRC-Holland ®

MLPA

Description version 17; 07 December 2016 Length SALSA MLPA (nt) probe

Gene

Ligation site

MV location (hg18)

NM_001065.3; 272-273

12-006.321242

175

00554-L13516

TNFRSF1A

444

00678-L00124

CD27

274 «

07949-L07730

CDKN1B

229

02334-L01820

PAH

238 ¤ «

03813-L03753

CHFR

301 ¤

04042-L03755

BRCA2

418

01617-L01199

BRCA2

NM_000059.3; 9100-9101

13-031.851549

202

01245-L00793

MLH3

NM_001040108.1; 3553-3554

14-074.578837

281 «

01832-L01397

TSC2

NM_000548.3; 2080-2081

16-002.061787

337

02416-L01862

CDH1

NM_004360.3; 2654-2655

16-067.424756

436 ¤

07946-L07727

CDH13

220 «

03804-L00949

HIC1

246 ¤

05162-L04543

BRCA1

NM_007294.3; 178-179

17-038.530812

256

00587-L00382

BCL2

NM_000633.2; 1151-1152

18-058.946868

390

00713-L00108

KLK3

142

02255-L03752

TIMP3

NM_001242.4; 898-899; exon 6 NM_004064.4; 414-415; 157 nt before ATG NM_000277.1; 842-843

12-006.430703 12-012.761864 12-101.795401

NM_001161344.1; 116 nt before exon 1; 12-131.974373 407 nt before ATG, reverse NM_000059.3; 130-131; 13-031.787718 852 nt before ATG

NM_001257.3; 165-166; 42 nt after ATG NM_006497.3, 11 nt before exon 1

16-081.218220 17-001.905108

NM_001648.2; 19-056.050015 53-54 NM_000362.4; 1015-1016; 22-031.527796 172 nt before ATG

(partial) sequence with HhaI site GCCACACTGCCCTGAGCCCAAATGGGGGAGTGAGAGGCCATAGCTGTCTGGC GAAAGTCCTGTGGAGCCTGCAGAGCCTTGTCGTTACAGCTGCCCCAGGGAGG AGCCCCTGCGCGCTCCTAGAGCTCGGGCCGTGGCTCGTCGGGGTCTGTGTCTTT CAGTGCCCTGGTTCCCAAGAACCATTCAAGAGCTGGACAGATTTGCCAATCAGATTCTCAG CGCGAGAGTAGGCGCGTGGAGGAGCGCTCGGCCATCTTTGATCCTGACCAGGCGACTTCGT CGGGAGAAGCGTGAGGGGACAGATTTGTGCCGGCGCGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGA GGCCATGGAATCTGCTGAACAAAAGGAACAAGGTTTATCAAGGGATGTCACAACCGTGTGGAAGT TGCG GCGACCTTGTTCTTCCTTTCCTTCCGAGAGCTCGAGCAGAGAGGACTGTGATGAGACAGGATAACAG GAGCCAGAGAGAGGCTCTGAGAAGAAGACCAGCGGCCCCCTTTCTCCTCCCACAGGGCCTCCTG CTATGAAGGAAGCGGTTCCGAAGCTGCTAGTCTGAGCTCCCTGAACTCCTCAGAGTCAGACAAAGACCAG GAC TTCTGTGCGTTCTCCTGTCCCAGGTAGGGAAGAGGGGCTGCCGGGCGCGCTCTG CCGCTCCAGATAAGAGTGTGCGGAAAGCGCGGCGGGGCTGAGACGCGACCAGGAC TTCTCAGATAACTGGGCCCCTGCGCTCAGGAGGCCTTCACCCTCTGCTCTGGGTAAAGG CTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTG TGTGTCACCATGTGGGTCCCGGTTGTCTTCCTCACCCTGTCCGTGACGTGGA TCCAGCGCCGAGGCAGCCTCGCTGCGCCCCATCCCGTCCCGCCGGGCACTCGG

The HhaI sites are marked in grey. Ligation sites are marked with – « This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. ‡ Target sequence of this probe contains SNP rs104894994 (C/T) in the GCGC site, 6 nt right from the ligation site. This validated SNP with an allele frequency of 0.068%, when T-allele present, will inhibit the HhaI restriction, resulting in a false-positive methylation signal. ∫ Target sequence of this probe contains SNP rs3087462 (C/T) in the GCGC site, 3 nt right from the ligation site. This validated SNP with an allele frequency of 2.8%, when T-allele present, will inhibit the HhaI restriction, resulting in a false-positive methylation signal. ٨ Please treat positive signals indicating methylation of only the 211 nt CDKN2B probe with caution. This probe is incompletely digested when insufficient HhaI activity is present, e.g. in less pure samples, resulting in false positive results. ¤ These genes have a second probe in MLPA probemix ME002 Tumour suppressor mix 2, recognising a different CpG site. + More methylation probes for MLH1 are available in SALSA MLPA probemix ME011 MMR. The 167 nt probe is located in the Deng D-region. The 463 nt probe is located in the Deng B-region (Deng et al., 1999 Cancer Research 59; 2029-33). » The 161 nt CDKN2A probe detects a sequence in front of the P14–INK4A-ARF promoter of CDKN2A instead of the ordinary CDKN2A P16 promoter. More probes for CDKN2A and CDKN2B are available in SALSA MLPA probemix ME024 9p21 CDKN2A/CDKN2B region. ° Probe renamed (was LOC254312).

Entrez Gene shows transcript variants of each gene: http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene For NM_ mRNA reference sequences: http://www.ncbi.nlm.nih.gov/sites/entrez?db=nucleotide Note: Complete probe sequences are available on request: [email protected] Please notify us of any mistakes: [email protected]a.com.

SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 7 of 10

MRC-Holland ®

Description version 17; 07 December 2016

MLPA

SALSA MLPA probemix ME001-C2 Tumour suppressor mix 1 sample pictures

Figure 1. Capillary electrophoresis pattern of a sample of approximately 50 ng undigested human male control DNA analysed with SALSA MLPA probemix ME001-C2 Tumour suppressor mix 1 (lot C2-0815) for the quantification of copy numbers. Note: a non-specific peak is present at ~121 nt. This peak does not correspond to an MLPA probe.

SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 8 of 10

MRC-Holland ®

Description version 17; 07 December 2016

MLPA

Figure 2. Capillary electrophoresis pattern of a sample of approximately 50 ng digested human male control DNA analysed with SALSA MLPA probemix ME001-C2 Tumour suppressor mix 1 (lot C2-0815) to determine the methylation status. Note: a non-specific peak is present at ~121 nt. This peak does not correspond to an MLPA probe.

Implemented Changes – compared to the previous product description version(s).

Version 17 – 07 December 2016 (16) -

Warning regarding HhaI enzymes that are resistant to heat inactivation added under Methylationspecific MLPA section.

Version 16 – 28 November 2016 (15) -

Minor modification of the probemix name. Related SALSA MLPA probemixes and references added on page 2. Two probes renamed in Table 1 and Table 2. Footnotes added underneath Table 1 and Table 2. Column about the % of expected signal reduction added in Table 1. Ligation site and MV location adjusted for several probes in Table 2. Figure numbering modified on page 8. Various minor textual modifications.

Version 15 (14) -

Information in Table 1 and 2 corrected for the 292 nt probe 02203-L08261 as this probe is located in KLLN (transcript NM_001126049.1) upstream of PTEN. Related SALSA MLPA probemixes on page 2 modified. Two new references added on page 2.

Version 14 (13) - Various textual and lay-out changes.

Version 13 (09) - Warning added in Table 1 and 2, 220 nt probe 03804-L00949, 238 nt probe 03813-L03753, 281 nt probe 01832-L01397, 400 nt probe 04050-L01263, and 463 nt probe 02260-L01747.

Version 12 (48) - Electropherogram pictures using the new MLPA buffer (introduced in December 2012) added. SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 9 of 10

MRC-Holland ®

Description version 17; 07 December 2016

MLPA

Version 11 (48) - Various minor textual changes. - Warning added about a non-specific peak in the no DNA control.

Version 08 (06) - Small changes of probe lengths in Table 1 and 2 in order to better reflect the true lengths of the amplification products. - Inclusion of probe ligation sites according to NM_ mRNA reference sequences or relative to the ATG translation start site in Table 2.

SALSA MLPA probemix ME001 Tumour suppressor mix 1

Page 10 of 10